ID: 1103372377

View in Genome Browser
Species Human (GRCh38)
Location 12:120429519-120429541
Sequence CAGGCGACTTAGAAGTTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103372372_1103372377 -1 Left 1103372372 12:120429497-120429519 CCTGCTCTCGTGAAGCTTTTCCC No data
Right 1103372377 12:120429519-120429541 CAGGCGACTTAGAAGTTAATGGG No data
1103372371_1103372377 0 Left 1103372371 12:120429496-120429518 CCCTGCTCTCGTGAAGCTTTTCC No data
Right 1103372377 12:120429519-120429541 CAGGCGACTTAGAAGTTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103372377 Original CRISPR CAGGCGACTTAGAAGTTAAT GGG Intergenic
No off target data available for this crispr