ID: 1103380153

View in Genome Browser
Species Human (GRCh38)
Location 12:120487940-120487962
Sequence TCCCTATGTTGAGGGAGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 623
Summary {0: 1, 1: 20, 2: 41, 3: 36, 4: 525}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103380150_1103380153 8 Left 1103380150 12:120487909-120487931 CCATAAAACAAAGGAAAATTTGT 0: 26
1: 17
2: 18
3: 83
4: 931
Right 1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG 0: 1
1: 20
2: 41
3: 36
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103380153 Original CRISPR TCCCTATGTTGAGGGAGTAC TGG Intronic
901416684 1:9121377-9121399 TCCCTAAGTTCTGGGATTACAGG - Intronic
901557328 1:10041951-10041973 TCCCAAAGTTGTGGGATTACAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902734682 1:18392333-18392355 TCCCAAAGTGGAGGGATTACAGG - Intergenic
903040702 1:20527920-20527942 TCCCTAAGTAGCGGGATTACAGG - Intergenic
903111600 1:21139329-21139351 TCCCAATGTTCTGGGATTACAGG - Intronic
903429863 1:23287180-23287202 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
903531948 1:24037709-24037731 TCCCTAAGTTTTGGGATTACAGG + Intergenic
904252471 1:29235079-29235101 TCCCAATGTGCAGGGATTACAGG - Intergenic
904778948 1:32930366-32930388 TCCCAATGTTCCGGGATTACAGG + Intergenic
904926628 1:34054461-34054483 TCCCAAAGTTCAGGGATTACAGG - Intronic
905142553 1:35859626-35859648 TCCCTATGTGCTGGGATTACAGG + Intergenic
905933147 1:41803791-41803813 TCCCCTTGTTGAGGGATCACGGG + Intronic
906876613 1:49545894-49545916 TCCATAAGTTATGGGAGTACAGG + Intronic
907286973 1:53386951-53386973 TCCCTATCTTGTGTGAGTCCAGG - Intergenic
908233895 1:62132104-62132126 TCCCAAAGTTCTGGGAGTACAGG + Intronic
908256208 1:62305567-62305589 TCCCAAAGTTCAGGGATTACAGG + Intronic
908307550 1:62838517-62838539 TCCCAAAGTGGAGGGATTACAGG - Intronic
908320128 1:62970852-62970874 TCCCAAAGTGGAGGGATTACAGG - Intergenic
908728025 1:67197684-67197706 TCCCAAAGTTCAGGGATTACAGG - Intronic
909146785 1:71944418-71944440 TCCCTAAATTGAGGGAATAAAGG + Intronic
909635433 1:77812053-77812075 TCCCTAAGTTATGGGATTACAGG - Intronic
909646421 1:77922024-77922046 TCCCAAAGTTGGGGGAATACAGG + Intronic
910178373 1:84455374-84455396 TCCCAATGTTCTGGGATTACAGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
910775754 1:90872939-90872961 TCCCTAAGTGGTAGGAGTACAGG + Intergenic
911349299 1:96733418-96733440 TCCCTAAGTTCTGGGATTACAGG - Intronic
911762275 1:101630130-101630152 TCCCTGAGTTCAGGGAATACAGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912914476 1:113799299-113799321 TCCCTAAGTTCTGGGATTACAGG + Intronic
914048617 1:144113298-144113320 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
914130567 1:144852150-144852172 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915542554 1:156577424-156577446 TCCCAAAGTTGTGGGATTACAGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916032379 1:160889091-160889113 TCCCATTGTTGAGGGAGAAGAGG - Intergenic
916310129 1:163388850-163388872 TCCCAAAGTGCAGGGAGTACAGG + Intergenic
916359818 1:163956044-163956066 TCCCAATGTTCTGGGATTACAGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
916656667 1:166882784-166882806 TCCCTAAGTGGTGGGATTACAGG + Intergenic
916875605 1:168965112-168965134 TCCCTAAGTTTTGGGATTACAGG - Intergenic
917943295 1:179944848-179944870 TCCCAAAGTTGTGGGATTACAGG + Intergenic
918314730 1:183313742-183313764 TCCCAATGTGCAGGGATTACAGG + Intronic
918810377 1:189110804-189110826 TCCCAATGTTCTGGGATTACAGG + Intergenic
919264690 1:195247373-195247395 TCCCAATGTGGTGGGATTACAGG - Intergenic
919437559 1:197580860-197580882 TCCTTATGTTGAGACAGTACAGG - Intronic
919523097 1:198613602-198613624 TCCCTAAGTTCTGGGATTACAGG + Intergenic
919663227 1:200268400-200268422 TCCCAAAGTTGTGGGATTACAGG - Intergenic
920513948 1:206570350-206570372 TCCCTAAGTTCTGGGATTACAGG + Intronic
921352011 1:214245457-214245479 TCCCAATGTACTGGGAGTACAGG + Intergenic
921832806 1:219747079-219747101 TCCCTAAGTTTTGGGATTACAGG - Intronic
923455938 1:234165642-234165664 TCCCTATGTACTGGGATTACAGG + Intronic
923643810 1:235794089-235794111 TCCCAAAGTTCAGGGATTACAGG + Intronic
924314215 1:242778924-242778946 TCCCGAAGTGGAGGGATTACAGG - Intergenic
1063291539 10:4754909-4754931 TCCCAATGTTCTGGGATTACAGG - Intergenic
1064079912 10:12300031-12300053 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1064399182 10:15006668-15006690 TCCCAATGTTCTGGGATTACAGG - Intergenic
1064897346 10:20253104-20253126 TCCCAATGTTCTGGGATTACAGG - Intronic
1065105372 10:22378320-22378342 TCCCTAAGTTCTGGGATTACAGG + Intronic
1065495700 10:26325438-26325460 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1065936313 10:30523458-30523480 TCCCAAAGTGGTGGGAGTACAGG + Intergenic
1067581832 10:47451205-47451227 TCCCAATGTTCTGGGATTACAGG + Intergenic
1068236102 10:54234427-54234449 TCCCTAAGTTCTGGGATTACAGG - Intronic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1068661491 10:59627530-59627552 TCCCTGTGCTGTGGGATTACAGG + Intergenic
1069010327 10:63364743-63364765 TCCCTAAGTGCTGGGAGTACAGG + Intronic
1069557989 10:69410256-69410278 TCCCAAAGTTTAGGGATTACAGG - Intronic
1071576052 10:86727278-86727300 TCCCCAAGTTGTGGGAATACAGG + Intronic
1071701964 10:87948679-87948701 TCCCAAAGTTAAGGGATTACAGG - Intronic
1072154268 10:92709735-92709757 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1072387564 10:94946856-94946878 TCCCAAAGTTGTGGGATTACAGG - Intronic
1072548587 10:96459368-96459390 TCCCTAAGTTCTGGGATTACAGG - Intronic
1072585339 10:96776691-96776713 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1073801129 10:107042866-107042888 TCCCAATGTTCTGGGATTACAGG + Intronic
1073927518 10:108534127-108534149 TCGCTATGTTGGGGAAGTTCTGG - Intergenic
1074529475 10:114287437-114287459 TCCCAAAGTGGAGGGATTACAGG + Intronic
1074874940 10:117606428-117606450 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1074998000 10:118774285-118774307 TCCCAAAGTTTAGGGATTACAGG + Intergenic
1075090308 10:119440807-119440829 TCCCTATGTGCTGGGATTACAGG + Intronic
1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG + Intronic
1075683072 10:124346064-124346086 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079221481 11:18565568-18565590 TCCCAAAGTTCAGGGATTACAGG - Intronic
1079230063 11:18641978-18642000 TATCTATGTTGAGAGATTACAGG - Intergenic
1079742259 11:24077371-24077393 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080543087 11:33288192-33288214 TCCCTAAGTGCAGGGATTACAGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081196256 11:40164493-40164515 TCCCAATGTGCAGGGATTACAGG + Intronic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1084307349 11:68295711-68295733 TCCCAAAGTGGAGGGATTACAGG - Intergenic
1085276374 11:75302733-75302755 TCCCTGTGTTGAGTCACTACTGG - Intronic
1085309659 11:75508765-75508787 GCCCTATGTGGGGGGAGTAGGGG - Intronic
1086459466 11:86991842-86991864 TCCCAAGGTTCAGGGATTACAGG + Intergenic
1086536007 11:87847613-87847635 TCCCTGTGTGGAGTGAGTAGGGG + Intergenic
1086737674 11:90327078-90327100 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087382453 11:97423989-97424011 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1087734829 11:101820242-101820264 TCCCAAAGTTCAGGGATTACAGG - Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1089060432 11:115621911-115621933 TCCCAATGTTCTGGGATTACAGG + Intergenic
1089804215 11:121068623-121068645 TCCCTAAGTGGTGGGATTACAGG - Intronic
1090286309 11:125502556-125502578 TCCCAAGGTTCAGGGATTACAGG - Intergenic
1090624555 11:128594642-128594664 TGGCTATGTTGAGGGAGTAAGGG - Intergenic
1090938790 11:131369513-131369535 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1091163057 11:133443848-133443870 TCCCAATGTTCTGGGATTACAGG - Intronic
1092676061 12:10922026-10922048 TCCCAATGTTCGGGGATTACAGG + Intronic
1092748299 12:11693947-11693969 TCCCTAGTTTGAGGGAGAATTGG - Intronic
1092795327 12:12105639-12105661 TCCCAAAGTTGGGGGATTACAGG - Intronic
1092983746 12:13824594-13824616 TCCCAAAGTGGAGGGATTACAGG - Intronic
1095581151 12:43801008-43801030 TCCCAAAGTTTAGGGATTACAGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096108259 12:49011818-49011840 TCCCAATGTGGTGGGATTACAGG + Intronic
1096349095 12:50879707-50879729 TCCCAAAGTTTAGGGATTACAGG - Intronic
1096567961 12:52496827-52496849 TCCCAGTGTGGAGGGAGGACAGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097256555 12:57680377-57680399 TCCCAATGTTCTGGGATTACAGG + Intergenic
1097773591 12:63619761-63619783 TCCCAAAGTTCTGGGAGTACAGG + Intronic
1098122482 12:67256595-67256617 TCCCTTGGTGGAGGGAGCACAGG - Intergenic
1098170184 12:67739050-67739072 TCCCTATGTGCTGGGATTACAGG + Intergenic
1098531824 12:71550389-71550411 TCCCTAAGTTCTGGGATTACAGG + Intronic
1098544144 12:71692934-71692956 TCCCTAAGTTTTGGGATTACAGG - Intronic
1100306535 12:93355050-93355072 TCCCTATGTGCTGGGATTACAGG - Intergenic
1102187671 12:110962265-110962287 TCCCAAGGTTCAGGGATTACCGG + Intergenic
1102342072 12:112129458-112129480 TCCCAAAGTTCTGGGAGTACAGG + Intronic
1102787583 12:115617162-115617184 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1102922216 12:116800236-116800258 TCCCAATGTGCAGGGATTACAGG - Intronic
1103369886 12:120410920-120410942 TCCCAATGTGTAGGGATTACAGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103380848 12:120493277-120493299 TCCCTAAGTTTTGGGATTACAGG - Intronic
1103879505 12:124155195-124155217 TCCCAAAGTTGTGGGATTACAGG - Intronic
1104623542 12:130336200-130336222 TCCCAATGTGCAGGGATTACAGG - Intergenic
1105882960 13:24619702-24619724 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1106543638 13:30712654-30712676 TCCCTAAGTGGTGGGACTACAGG + Intergenic
1107637253 13:42405126-42405148 TCCCTATGTGATGGGATTACAGG + Intergenic
1107685228 13:42890554-42890576 TCCCAATGTGGTGGGATTACAGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109270018 13:60245510-60245532 TCCCTATGTGAAGGGAGTAGTGG + Intergenic
1109308539 13:60665376-60665398 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109782525 13:67130664-67130686 TTCCTATGATGAGGCAGTTCTGG - Intronic
1109782530 13:67130705-67130727 TTCCTATGATGAGGCAGTTCTGG - Intronic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1110222997 13:73092445-73092467 TCCCAATGTTCTGGGATTACAGG - Intergenic
1110899253 13:80800099-80800121 TCCCAACGTTGTGGGATTACAGG - Intergenic
1113466333 13:110515981-110516003 TCGCTCTGTTGTGGGATTACAGG - Intergenic
1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG + Intergenic
1115203805 14:30879919-30879941 TCCCAAAGTTCAGGGATTACAGG + Intronic
1115531074 14:34327727-34327749 TCCCAAAGTTCAGGGATTACAGG + Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116730337 14:48613008-48613030 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1116904137 14:50388839-50388861 TCCCTAAGTACAGGGATTACAGG - Intronic
1116904673 14:50393057-50393079 ACCCTATATTGAGGGAACACAGG - Intronic
1117039759 14:51759138-51759160 TCCCAATGTTTTGGGATTACAGG + Intergenic
1118989420 14:70784482-70784504 TCCCAAAGTTGTGGGATTACAGG - Intronic
1119487997 14:75004430-75004452 TCCCAAAGTTGTGGGATTACAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120340016 14:83207852-83207874 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1121036888 14:90713372-90713394 TCCCAAAGTTCAGGGATTACAGG + Intronic
1121198619 14:92097781-92097803 TCCCTAAGTTCTGGGATTACAGG + Intronic
1122104806 14:99444598-99444620 TCCCAATGTGCAGGGATTACAGG - Intronic
1122299262 14:100722814-100722836 TCCCTGTGTTGAGGGCTTACAGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123418553 15:20112907-20112929 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1123527771 15:21119447-21119469 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1124111348 15:26791914-26791936 TCCCGAAGTTGTGGGATTACAGG + Intronic
1124422534 15:29535423-29535445 TCCCAAAGTTGTGGGATTACAGG - Intronic
1125103727 15:35946535-35946557 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1125812515 15:42553563-42553585 TCCCTAAGTGCAGGGATTACAGG + Intronic
1125867041 15:43061935-43061957 TCCCTAGGTTATTGGAGTACAGG - Intronic
1126459034 15:48895822-48895844 TCCCTAAGTGGTGGGATTACAGG - Intronic
1126611060 15:50530046-50530068 TCCCAAAGTTGTGGGATTACAGG - Intronic
1128143224 15:65316750-65316772 TCCCAATGTTCTGGGATTACAGG - Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1128948789 15:71852619-71852641 TCCCAAAGTGGAGGGATTACAGG + Intronic
1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG + Intergenic
1129145281 15:73641488-73641510 TCCTTGTGTGGAGGGAGAACTGG - Intergenic
1129547884 15:76417759-76417781 TCCCAAAGTTGTGGGATTACAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130012814 15:80165268-80165290 TCCCAAAGTTGTGGGATTACAGG - Intronic
1130093952 15:80842471-80842493 TCCCAAAGTTCTGGGAGTACAGG - Intronic
1131278722 15:91003963-91003985 TCCCTAAGTTCTGGGATTACAGG - Intronic
1131903271 15:97112498-97112520 TCCCAATGTTCTGGGATTACAGG - Intergenic
1132143201 15:99411317-99411339 ACCCTAAGTCGAAGGAGTACAGG + Intergenic
1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG + Intronic
1133925084 16:10185720-10185742 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1134476691 16:14580226-14580248 TCCCAAAGTTGGGGGATTACAGG + Intronic
1134528787 16:14965773-14965795 TCCCAATGTGCTGGGAGTACAGG + Intergenic
1135233420 16:20731122-20731144 TCCCAATGTTGTGGGATTATAGG + Intronic
1135354595 16:21758580-21758602 TCCCTATGTGAAGGCAGGACAGG - Intronic
1135453085 16:22574720-22574742 TCCCTATGTGAAGGCAGGACAGG - Intergenic
1135651682 16:24211816-24211838 TCCCAAAGTTCAGGGATTACAGG + Intronic
1136177292 16:28526180-28526202 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1136623899 16:31449731-31449753 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1137401724 16:48158895-48158917 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1137575140 16:49594384-49594406 TCCCTCTGTTGAGAGAGGCCTGG - Intronic
1137582827 16:49644394-49644416 ACCCAATGTTCAGGGATTACAGG - Intronic
1138014740 16:53418223-53418245 TCCCAATGTTTTGAGAGTACAGG + Intergenic
1139444936 16:66991848-66991870 TCCCAAAGTTCTGGGAGTACAGG - Intronic
1139540779 16:67614436-67614458 TCCCTAGGTGCAGGGATTACAGG - Intronic
1139613807 16:68076996-68077018 TCCCAAAGTTGTGGGATTACAGG - Intronic
1139716349 16:68816485-68816507 TCCCTAAGTTTTGGGATTACAGG - Intronic
1139841289 16:69882892-69882914 TCCCAAAGTTCTGGGAGTACAGG - Intronic
1139867576 16:70075206-70075228 TCCCAATGTGCTGGGAGTACAGG - Intergenic
1139910004 16:70391865-70391887 TCCCAATGTAGTGGGATTACAGG + Intronic
1140965782 16:79964615-79964637 TCCCAATGTTCTGGGATTACAGG + Intergenic
1141507861 16:84491179-84491201 TCCCAAAGTGGAGGGATTACAGG - Intronic
1142653913 17:1377170-1377192 TCCCTAGGTGGTGGGATTACAGG + Intronic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1143892217 17:10111274-10111296 TCCCAAAGTTGTGGGATTACAGG - Intronic
1144597076 17:16579177-16579199 TCCCAAAGTGGAGGGATTACAGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146103104 17:30004891-30004913 TCCCAAAGTTGTGGGATTACAGG + Intronic
1146559309 17:33854567-33854589 TCCCTACTTTGAGGGAATCCTGG - Intronic
1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG + Intronic
1147289215 17:39428224-39428246 TCCCAAAGTTGTGGGATTACAGG - Intronic
1147392108 17:40116194-40116216 TCCCTATTAGGAGGGACTACAGG + Intergenic
1148158883 17:45438813-45438835 TCCCAAAGTTGTGGGATTACAGG + Intronic
1148184705 17:45633746-45633768 TCCCAAAGTGTAGGGAGTACAGG - Intergenic
1148234536 17:45959547-45959569 TCCCAAAGTTTAGGGATTACAGG - Intronic
1150097030 17:62385983-62386005 TCCCTAAGTGCAGGGATTACAGG + Intronic
1150271341 17:63867404-63867426 TCCCAATGTGCTGGGAGTACAGG + Intergenic
1150279567 17:63921312-63921334 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1150351287 17:64446837-64446859 TCCCGAAGTTGTGGGATTACAGG - Intergenic
1150393275 17:64802437-64802459 CTCCTACGTTGAGGGACTACGGG - Intergenic
1150843766 17:68634244-68634266 TCCCAAAGTTGTGGGACTACTGG + Intergenic
1151635544 17:75345300-75345322 TCCCAAAGTTGTGGGATTACAGG + Intronic
1151784334 17:76267915-76267937 TCCCAAAGTTCAGGGATTACAGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1154137266 18:11790913-11790935 TCCCTAAGTTCTGGGATTACAGG + Intronic
1155077653 18:22374791-22374813 TCCCAATGTTCTGGGATTACAGG - Intergenic
1155532607 18:26782358-26782380 TTCCAAGGTTGAGGGAGTTCAGG + Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156266666 18:35495168-35495190 TCCCAAAGTTTAGGGATTACAGG - Intronic
1158455242 18:57600326-57600348 TCCCAAAGTGGAGGGATTACAGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159402811 18:67959529-67959551 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1160137263 18:76282977-76282999 TCCCTATGTGCTGGGATTACAGG + Intergenic
1160315027 18:77835207-77835229 TCCATATGCTGAGAGAGCACAGG - Intergenic
1160784784 19:894823-894845 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1160850898 19:1191717-1191739 TCCCAAAGTTGTGGGACTACAGG + Intronic
1161167016 19:2793431-2793453 TCCCAATGTGCAGGGATTACAGG - Intronic
1161749326 19:6083028-6083050 TCCCTGGGCTCAGGGAGTACGGG + Intronic
1161818601 19:6515675-6515697 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1161875726 19:6907596-6907618 TCCCAATGTTCTGGGATTACAGG + Intronic
1162703164 19:12534553-12534575 TCCCAAAGTTGTGGGATTACAGG - Intronic
1163121100 19:15218411-15218433 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1163259718 19:16181315-16181337 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1163319853 19:16568250-16568272 TCCCTTTGCTGAGGGAGGAGAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163424716 19:17235164-17235186 GCCCTTTGGTGAGGGAGTAGGGG + Intronic
1163434963 19:17289938-17289960 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1163706648 19:18818110-18818132 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1163802618 19:19375992-19376014 TCCCAAAGTGGAGGGATTACAGG + Intergenic
1163877040 19:19880444-19880466 TCCCACTGTTCTGGGAGTACAGG - Intronic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164082161 19:21867879-21867901 TCCCAATGTAGTGGGATTACAGG + Intergenic
1164308355 19:24024827-24024849 TCCCAATGTAGTGGGATTACAGG + Intergenic
1164315268 19:24081862-24081884 TCCCAATGTGCAGGGATTACAGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164890863 19:31821958-31821980 TCCCAATGTTCTGGGATTACAGG - Intergenic
1165357485 19:35312777-35312799 TCCCAAAGTTGTGGGATTACAGG - Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1166352198 19:42204674-42204696 TCCCAGTGTTGTGGGAGCACAGG - Intronic
1166549048 19:43652907-43652929 TCCCAATGTTCTCGGAGTACAGG + Intronic
1167111801 19:47466806-47466828 TCCCAAAGTTCAGGGATTACAGG - Intronic
1167254493 19:48419135-48419157 TCCCAAAGTTCTGGGAGTACAGG + Intronic
1167341657 19:48920025-48920047 TCCCTAAGTGGTGGGATTACAGG + Intronic
1167385860 19:49163018-49163040 TCCCTAAGTTCTGGGATTACAGG + Intronic
1167440159 19:49503700-49503722 TCCCTAAGTAGTGGGATTACAGG - Intergenic
1167479161 19:49718823-49718845 TCCCTAGGTGCAGGGATTACAGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1168603831 19:57742271-57742293 TCCCAATGTTCTGGGATTACAGG - Intronic
1168610384 19:57794646-57794668 TCCCAATGTTCTGGGATTACAGG + Intronic
1202688070 1_KI270712v1_random:66201-66223 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
926733476 2:16055241-16055263 TCCCTATGTGTTGGGATTACAGG - Intergenic
926738537 2:16092541-16092563 TCCCAAAGTTCAGGGATTACAGG + Intergenic
926989355 2:18660880-18660902 TCCCAAAGTTGTGGGATTACAGG - Intergenic
927017740 2:18984007-18984029 TCCCAAAGTTCAGGGATTACAGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927689690 2:25199447-25199469 TCCCTAAGTTCTGGGATTACAGG - Intergenic
927788526 2:25991426-25991448 TCCCTAAGTGGTGGGATTACAGG - Intergenic
927977198 2:27347873-27347895 TCCCTAAGTGCAGGGATTACAGG - Intronic
928520949 2:32088144-32088166 TCCCAAAGTGGTGGGAGTACAGG + Intronic
929205672 2:39289824-39289846 TCCCAAAGTTGTGGGATTACAGG - Intronic
929589351 2:43134916-43134938 TCCCAATGTTCTGGGATTACAGG - Intergenic
929698710 2:44142762-44142784 TCCCAATGTTCTGGGATTACAGG - Intergenic
929719898 2:44357062-44357084 TCCCAATGTTCTGGGATTACTGG + Intronic
930055844 2:47251338-47251360 TCCCAAAGTGGTGGGAGTACAGG + Intergenic
930086500 2:47501348-47501370 TCCCAAAGTGCAGGGAGTACAGG + Intronic
930284169 2:49407309-49407331 ACTCTGTGTTGAGTGAGTACAGG - Intergenic
930768105 2:55105486-55105508 TCCCAAAGTTGTGGGATTACAGG + Intronic
930991698 2:57663912-57663934 TCCCAAAGTTGTGGGATTACAGG - Intergenic
932033936 2:68221071-68221093 TCCCAATGTGGTGGGATTACAGG - Intronic
932350923 2:71031091-71031113 TCCCAATGTTCTGGGACTACAGG + Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
932687729 2:73887389-73887411 TCCCAAAGTTCAGGGATTACAGG - Intergenic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933958284 2:87389393-87389415 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
934242410 2:90281310-90281332 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
934270764 2:91535373-91535395 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
936615970 2:114048154-114048176 TCCCTATGTGCAGGGAGGAGGGG - Intergenic
938006815 2:127793874-127793896 TCCCAAAGTTCAGGGATTACAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938485860 2:131707310-131707332 TCCCTAAGTGGTGGGATTACAGG + Intergenic
940873155 2:158876861-158876883 TCCCAATGTTCTGGGATTACAGG + Intergenic
942187321 2:173436733-173436755 TCCCAATGTTCTGGGATTACAGG + Intergenic
942903839 2:181157068-181157090 TCCCAATGTTGAAGGAGGCCTGG - Intergenic
944278912 2:197871888-197871910 TCCCTTTGTAGAGGGTGTAAAGG - Intronic
944360516 2:198850183-198850205 TCCATATGTTATTGGAGTACAGG - Intergenic
944620252 2:201506809-201506831 TCCCAAAGTTTAGGGATTACAGG + Intronic
945253464 2:207784172-207784194 TCTCTAAGTTGGGGGATTACAGG - Intergenic
945683785 2:212944628-212944650 TCCATTTGTTCAGTGAGTACCGG - Intergenic
946567954 2:220988381-220988403 TCCCTAAGTTCTGGGATTACAGG - Intergenic
947423118 2:229958525-229958547 TCCCTAAGTGGTGGGATTACAGG + Intronic
947894253 2:233654831-233654853 TCCCTAAGTGCAGGGATTACAGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169055946 20:2621102-2621124 TCCCAAAGTTGTGGGATTACAGG - Intronic
1169183085 20:3588104-3588126 TCCCTAAGTTCTGGGATTACAGG + Intronic
1169428372 20:5513548-5513570 TCCCTAAGTGGTGGGATTACAGG + Intergenic
1170307382 20:14953561-14953583 TCCCAAAGTTCAGGGATTACAGG + Intronic
1170686040 20:18570417-18570439 TCCCAAAGTGCAGGGAGTACAGG - Intronic
1171065317 20:22009360-22009382 TCCCAAAGTTGTAGGAGTACAGG + Intergenic
1171286765 20:23946095-23946117 TCCCTATGTCCAGGGTGTCCAGG + Intergenic
1171981893 20:31634301-31634323 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1172476955 20:35246194-35246216 TCCCAAAGTTGTGGGATTACAGG - Intronic
1172538345 20:35691790-35691812 TCCCAAAGTGGAGGGATTACAGG - Intronic
1172899032 20:38320719-38320741 TCACTATGATGAGGGAGAAGGGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173708131 20:45129187-45129209 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1174015992 20:47488698-47488720 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1174328993 20:49802783-49802805 CACCTGTGTTGAGGGTGTACCGG + Intergenic
1174783847 20:53414330-53414352 CCACTATGTTGAGCCAGTACTGG - Intronic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177272642 21:18869639-18869661 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1177644616 21:23885968-23885990 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1178347730 21:31846073-31846095 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1178948998 21:36970489-36970511 TCCCAAAGTTGTGGGATTACAGG + Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181350661 22:22255624-22255646 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1181541853 22:23577789-23577811 TCCCAAAGTTGTGGGATTACAGG + Intronic
1181907730 22:26212679-26212701 TCCCAATGTGGTGGGATTACAGG + Intronic
1183204101 22:36406614-36406636 TCCCTAAGTGCAGGGATTACAGG + Intergenic
1183868502 22:40723133-40723155 TCCCTAAGTGCAGGGATTACAGG - Intergenic
1184080907 22:42219595-42219617 TCCCAAAGTTCAGGGATTACAGG - Intronic
1184345080 22:43908216-43908238 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1184368340 22:44067098-44067120 TCCCAATGTGCTGGGAGTACAGG + Intronic
950065691 3:10109760-10109782 TCCCAATGTGGTGGGATTACAGG + Intergenic
951047511 3:18056888-18056910 TCCCAAAGTTGTGGGATTACAGG + Intronic
951780683 3:26359984-26360006 TCCCTATTTGGTGGGACTACAGG + Intergenic
953028623 3:39161174-39161196 TCCCTAAGTTCTGGGATTACAGG + Intergenic
953252324 3:41257371-41257393 TCCCTAAGTTTTGGGATTACAGG - Intronic
953971563 3:47352461-47352483 TCCCAAAGTGGAGGGATTACAGG - Intergenic
955737348 3:62053523-62053545 TCCCAAAGTTGTGGGATTACAGG + Intronic
956046658 3:65202955-65202977 TCCCAAAGTTCAGGGACTACAGG - Intergenic
956518829 3:70081369-70081391 TCCCAAAGTGGAGGGATTACAGG + Intergenic
957826119 3:85446858-85446880 TCCCTATGTGCTGGGATTACAGG + Intronic
959665107 3:108911845-108911867 TCCCAAAGTTCAGGGATTACAGG - Intronic
959700889 3:109298321-109298343 TCCCTGAGTTCAGGGATTACAGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960492212 3:118331888-118331910 CCCCAATGTTGAGGGAGAAACGG + Intergenic
961273193 3:125705514-125705536 TCCCAATGTTCTGGGATTACAGG + Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
961696793 3:128710806-128710828 TCCCAAAGTTCAGGGATTACAGG + Intergenic
962902124 3:139770503-139770525 TCCCAAAGTTCAGGGATTACAGG + Intergenic
963599856 3:147369469-147369491 TCCCTACGTTCAGCGAATACAGG + Intergenic
964007011 3:151842803-151842825 TCCCAAAGTAGAGGGATTACAGG + Intergenic
964021040 3:152011242-152011264 TCCCAAAGTTCAGGGATTACAGG - Intergenic
964334848 3:155644342-155644364 TCCCTAAGTTCTGGGATTACAGG - Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
964738320 3:159939553-159939575 TCCCAAAGTGGAGGGATTACTGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966094347 3:176180732-176180754 TCCATATGTTATTGGAGTACAGG + Intergenic
966129124 3:176616628-176616650 TCCCAATGTTCTGGGATTACAGG + Intergenic
966189250 3:177256759-177256781 TCCCAAAGTTGTGGGATTACAGG + Intergenic
966237059 3:177713481-177713503 TCCCTATGTGCTGGGATTACAGG + Intergenic
967305393 3:188054008-188054030 TCCCTATGTGGACGGAGAACAGG - Intergenic
968692284 4:1998740-1998762 TCTCTAGGTTGAGGAAGTTCTGG - Intronic
968842018 4:3014533-3014555 TCCCTAAGTGGTGGGATTACAGG - Intronic
969732827 4:8966954-8966976 TCCCAATGTTGTGGAATTACAGG - Intergenic
969735150 4:8983579-8983601 TCCCAATGTTCTGGGATTACAGG + Intergenic
970521045 4:16884064-16884086 TCCCTTTGTGGAGGGTGGACTGG - Intronic
970917067 4:21348436-21348458 TCCCTATGCTGTAGGAGCACAGG - Intronic
970933199 4:21537753-21537775 TCCCAAAGTTCAGGGATTACAGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
971955088 4:33407238-33407260 TCCCAATGTAGTGGGATTACAGG - Intergenic
972465445 4:39351701-39351723 TCCCAAAGTGGAGGGATTACAGG - Intronic
972585316 4:40432110-40432132 TCCCTATGTGCTGGGATTACAGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
972693877 4:41425603-41425625 TCCCTAAGTTCTGGGATTACAGG + Intronic
972942876 4:44218390-44218412 TCCCAAAGTGGTGGGAGTACAGG + Intronic
974263149 4:59551001-59551023 TCCCTAAGTTCTGGGATTACAGG - Intergenic
974438497 4:61886903-61886925 TCCCAAAGTTCTGGGAGTACAGG + Intronic
974439088 4:61893967-61893989 TCCCAAAGTTCTGGGAGTACAGG + Intronic
974963044 4:68727313-68727335 TCCCAATGTTCTGGGATTACAGG + Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975452946 4:74551336-74551358 TCCCAAAGTGGAGGGATTACAGG - Intergenic
975830875 4:78367144-78367166 TCCCTAAGTGGTGGGATTACAGG - Intronic
975894992 4:79078472-79078494 TTCCCATGTTGAGGCAGTTCTGG + Intergenic
976073885 4:81274308-81274330 TGCTTATATTCAGGGAGTACAGG - Intergenic
976147377 4:82055323-82055345 TGCCTATGTTGAGGAAGGAATGG + Intergenic
976710484 4:88065696-88065718 TCTCTGTGTTGAGGGTGAACTGG + Intronic
976997798 4:91457406-91457428 TCCCAAAGTGTAGGGAGTACAGG - Intronic
977210163 4:94208937-94208959 TCAATATTTTGAGGGAATACTGG - Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
979046765 4:115876620-115876642 TCCCTAAGTTCTGGGATTACAGG - Intergenic
979566090 4:122155580-122155602 TCCCTAAGTGGTGGGATTACAGG + Intronic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980395158 4:132203664-132203686 TCCCAAAGATGAGGAAGTACTGG + Intergenic
982667788 4:158287990-158288012 TCCCAAAGTTCAGGGATTACAGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983691474 4:170474223-170474245 TGTCTATGTTGAGAGGGTACAGG - Intergenic
985322744 4:188733067-188733089 TCCCAAAGTTCAGGGATTACAGG + Intergenic
987015148 5:13810480-13810502 TCCCAAAGTGGTGGGAGTACAGG - Intronic
987365911 5:17148449-17148471 TCCCAAAGTGGTGGGAGTACAGG + Intronic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
988158642 5:27490214-27490236 TCCCAAAGTTGTGGGATTACAGG - Intergenic
989331260 5:40261689-40261711 TCCCAATGTGGTGGGATTACAGG - Intergenic
989372548 5:40724374-40724396 TCCCAATGTTCCGGGATTACAGG - Intronic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
991399889 5:66241224-66241246 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
991577018 5:68115224-68115246 TCCCTAAGTGGTGGGATTACAGG + Intergenic
991583233 5:68178024-68178046 TCCCAAAGTGGAGGGATTACAGG - Intergenic
992717772 5:79528069-79528091 TCCCAAAGTTCAGGGATTACAGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
993644601 5:90446914-90446936 TCCCAAAGTTGTGGGATTACAGG + Intergenic
994290053 5:98018713-98018735 TCCCAAAGTTTAGGGATTACAGG + Intergenic
994748761 5:103711958-103711980 TCCCAAAGTGAAGGGAGTACAGG + Intergenic
995108032 5:108397755-108397777 TCCCTAAGTTCTGGGATTACAGG + Intergenic
995167275 5:109058996-109059018 TCCCTAAGTGGTGGGATTACAGG + Intronic
995818338 5:116197638-116197660 TCCCTACGTTCTGGGATTACAGG + Intronic
996047317 5:118887897-118887919 TCCCAAAGTTGTGGGATTACAGG + Intronic
996075975 5:119194794-119194816 TCCCAATGTTCTGGGATTACAGG - Intronic
997342349 5:133154499-133154521 TCCCAATGTGCAGGGATTACAGG - Intergenic
997565061 5:134880699-134880721 TCCCTAAGTGCTGGGAGTACAGG + Intronic
997761413 5:136451771-136451793 TCCATAAGTTGTGGGGGTACAGG - Intergenic
998263494 5:140649093-140649115 TCCCAAAGTGGTGGGAGTACAGG + Intronic
998839278 5:146235946-146235968 TCCCAAAGTTCAGGGATTACAGG + Intronic
999181448 5:149672535-149672557 TCCCAATGTTCTGGGATTACAGG - Intergenic
999996066 5:157093686-157093708 TCCCAATGTTTTGGGATTACAGG - Intronic
1000099968 5:158006650-158006672 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1000897353 5:166871915-166871937 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1001147740 5:169199636-169199658 TCCCTATATTTAGGAAATACTGG + Intronic
1002119784 5:176993747-176993769 TCCCAATGTGGTGGGATTACAGG - Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003917368 6:10799787-10799809 TCCCTAAGTTCTGGGATTACAGG - Intronic
1004388925 6:15193480-15193502 TCCCAATGTTCTGGGATTACAGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1004723000 6:18284775-18284797 TCCCTAAGTGGCGGGATTACAGG - Intergenic
1005258781 6:24034190-24034212 TCCCAAAGTGCAGGGAGTACAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005691794 6:28313557-28313579 TCCCCATCTTGGGGGAGAACAGG + Intergenic
1005698841 6:28379341-28379363 TCCCAAAGTTCAGGGATTACAGG - Exonic
1005808155 6:29494361-29494383 TCCCTAGGATGAGGGAGTCAGGG - Intergenic
1006148666 6:31974457-31974479 TCCCAAAGTGGTGGGAGTACAGG - Intronic
1006758775 6:36441006-36441028 TCCCTAAGTTTGGGGATTACAGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1006975663 6:38098406-38098428 TCCCAAAGTTGTGGGATTACAGG + Intronic
1007004484 6:38347736-38347758 TCCCAATGTGGTGGGATTACAGG - Intronic
1007218935 6:40263242-40263264 TCCCAAAGTTGTGGGACTACAGG - Intergenic
1008943897 6:57076140-57076162 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1011609615 6:89138181-89138203 TCCCTAAGTGTTGGGAGTACAGG + Intergenic
1011752564 6:90468130-90468152 TCCCAATGTTCTGGGATTACAGG + Intergenic
1011962606 6:93109759-93109781 ACCCTAGGCTGAGTGAGTACTGG - Intergenic
1012715691 6:102666540-102666562 TCCCAATGTTCTGGGATTACAGG - Intergenic
1012820296 6:104078416-104078438 TCCCTATGTGCTGGGAGTACAGG + Intergenic
1013094938 6:106936015-106936037 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1013101335 6:106989498-106989520 TCCCAATGTGGTGGGATTACAGG - Intergenic
1013491784 6:110654680-110654702 TCCCAATGTTCTGGGATTACAGG - Intronic
1013785087 6:113770319-113770341 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1013801914 6:113955767-113955789 TCCCAAAGTGGAGGGATTACAGG + Intronic
1014259211 6:119197048-119197070 TCCCAATGTTCTGGGATTACAGG - Intronic
1014273865 6:119365104-119365126 TAACTATGTGGAGGGAGTAGGGG - Intergenic
1014601334 6:123416959-123416981 TCCCAAAGTTGTGGGATTACAGG + Intronic
1015089152 6:129333148-129333170 TCCCAAAGTTCAGGGATTACAGG + Intronic
1015190671 6:130468258-130468280 TCCCTCTGATGAGGGGGCACCGG - Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1016493754 6:144635795-144635817 TCCCAAAGTTCTGGGAGTACAGG + Intronic
1016739137 6:147509372-147509394 TCCTTACCTTGCGGGAGTACGGG - Exonic
1017659100 6:156656503-156656525 TCCCAATGTTCTGGGATTACAGG - Intergenic
1018550290 6:164989872-164989894 TCCCTATGTGCTGGGATTACAGG + Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1020049215 7:5070954-5070976 TCCCTAAGTTCTGGGATTACAGG + Intronic
1020308452 7:6852495-6852517 TCCCAATGTTGTGGAATTACAGG + Intergenic
1020447077 7:8280358-8280380 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1020738990 7:11989465-11989487 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1021542907 7:21780284-21780306 TCCCTAAGTGCAGGGATTACAGG - Intronic
1021640412 7:22730746-22730768 TCCCAAAGTTTAGGGAATACAGG - Intronic
1022136903 7:27457543-27457565 TTCCTATTTAGAGGGAGTCCTGG - Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1022715964 7:32898797-32898819 TCCCTATGTGCTGGGATTACAGG + Intergenic
1023560808 7:41471502-41471524 TCCCTAAGTACTGGGAGTACAGG - Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024643070 7:51347535-51347557 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1025220447 7:57103269-57103291 TCCCTCTGTGGTGGGAGAACTGG + Intergenic
1025631264 7:63275090-63275112 TCCCTCTGTGGTGGGAGAACTGG + Intergenic
1026220446 7:68392009-68392031 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG + Exonic
1027001981 7:74659799-74659821 TCCCAAAGTGGTGGGAGTACAGG + Intronic
1027134210 7:75612548-75612570 TCCCAAAGTTCAGGGATTACGGG - Intronic
1027884648 7:83889407-83889429 TCCCAATGTGGTGGGATTACAGG - Intergenic
1027931529 7:84541783-84541805 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1028156345 7:87434198-87434220 TCCCAAAGTTGTGGGATTACAGG + Intronic
1029523346 7:101078800-101078822 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1031494131 7:122425327-122425349 TCCCAATGTGCAGGGATTACAGG - Intronic
1031858105 7:126946241-126946263 TCCCAATGTTCTGGGATTACAGG - Intronic
1032070534 7:128803390-128803412 TCCCAAAGTGGTGGGAGTACAGG - Intronic
1032391755 7:131559559-131559581 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG + Intergenic
1032960293 7:137025888-137025910 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033608037 7:142941699-142941721 TGAGTCTGTTGAGGGAGTACAGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034433349 7:151051661-151051683 TCCCAAAGTGCAGGGAGTACAGG + Intronic
1035694916 8:1588641-1588663 TCCCAAAGTTGTGGGATTACAGG - Intronic
1035987157 8:4446877-4446899 TCCCAATGTTCTGGGATTACAGG + Intronic
1036508887 8:9382250-9382272 TCCCTAAGTTTTGGGATTACAGG + Intergenic
1037436706 8:18870839-18870861 TCCCTAAGTGGTGGGATTACAGG - Intronic
1037868442 8:22467683-22467705 TCCCAATGTTCTGGGATTACAGG + Intronic
1038967862 8:32595445-32595467 TCCGTAAGTTGGGGGATTACAGG + Intronic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039526247 8:38218786-38218808 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1039634279 8:39145988-39146010 TCCCTAAGTTTTGGGATTACAGG + Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041038487 8:53820721-53820743 TCCCAAAGTTGTGGGATTACAGG - Intronic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1041994674 8:64039404-64039426 TACCTATATAGAGAGAGTACAGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043172357 8:76981210-76981232 TCCCAAAGTTGTGGGATTACAGG - Exonic
1043654345 8:82643125-82643147 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1043941769 8:86204443-86204465 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1045123972 8:99069172-99069194 TCCCAATGTGCAGGGATTACAGG - Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047116321 8:121845252-121845274 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1047380975 8:124362401-124362423 TCCCAAAGTTGTGGGATTACAGG - Intronic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1047644940 8:126860636-126860658 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1052968755 9:34363537-34363559 CCCCTATGTTTGGGGAGTAGAGG + Intergenic
1053061755 9:35037302-35037324 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1053170832 9:35881258-35881280 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054267930 9:62937935-62937957 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055093364 9:72385466-72385488 TTAGTATGTTGAGGGAGTTCAGG - Intergenic
1055568239 9:77590346-77590368 TCACATTCTTGAGGGAGTACAGG + Intronic
1055957950 9:81791944-81791966 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1056866785 9:90234294-90234316 TCCCAATGTTCTGGGATTACAGG + Intergenic
1056916375 9:90750041-90750063 TCCCAATGTTCTGGGATTACGGG - Intergenic
1059606166 9:115838771-115838793 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1060017150 9:120096683-120096705 TTCCTCTGCTGAGGGAGTAGGGG + Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1060500327 9:124148710-124148732 TCCCTATGTGCTGGGATTACAGG + Intergenic
1060538080 9:124407886-124407908 TCCCTAGGTTTTGGGATTACAGG - Intronic
1060615356 9:125008101-125008123 TCCCAAAGTTCAGGGATTACAGG + Intronic
1060633097 9:125177436-125177458 TCCCTAAGTGGTGGGATTACAGG - Intronic
1061029566 9:128071969-128071991 TCCCAAAGTTCAGGGATTACAGG + Intronic
1061161389 9:128896980-128897002 TCCCTAAGTTCTGGGATTACAGG + Intronic
1062039624 9:134398236-134398258 TCCCAAAGTTGTGGGATTACAGG + Intronic
1062724877 9:138066321-138066343 TCCCAAAGTTCTGGGAGTACAGG - Intronic
1185599192 X:1327389-1327411 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187333033 X:18357999-18358021 TCCCAAAGTGGAGGGATTACAGG - Intergenic
1187856270 X:23638543-23638565 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1188737624 X:33738333-33738355 TCCCAATGTTCTGGGATTACCGG - Intergenic
1189392382 X:40587009-40587031 TCCCTATGTGCTGGGATTACAGG - Intronic
1189765327 X:44366442-44366464 TCCCTAAGTTCTGGGATTACAGG - Intergenic
1189852993 X:45195383-45195405 ACCCTATGTTGAGGGACTTGGGG - Intronic
1190411123 X:50138306-50138328 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1190558802 X:51667024-51667046 TCCCAAAGTGGTGGGAGTACAGG - Intergenic
1190705523 X:53023775-53023797 TCCCAATGTTCTGGGATTACAGG + Intergenic
1190904477 X:54712059-54712081 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191787232 X:64929149-64929171 TCCCAAAGTTGTGGGACTACAGG + Intronic
1191859686 X:65656023-65656045 TCCCAAAGTTCAGGGATTACAGG + Intronic
1192022200 X:67405418-67405440 TCCCTATGTGCTGGGATTACAGG + Intergenic
1192216608 X:69163781-69163803 TCCCTCTGTTGCAGGATTACTGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1194124737 X:90002146-90002168 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1194926169 X:99827409-99827431 TCCTTAAGTTGTTGGAGTACAGG + Intergenic
1195302613 X:103545692-103545714 TCCCTATGTGCTGGGATTACAGG - Intergenic
1195371598 X:104180237-104180259 TCCCAATGTGGTGGGAATACAGG + Intronic
1196764057 X:119226905-119226927 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1196823062 X:119718720-119718742 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197787740 X:130216738-130216760 TCCCAAAGTTCAGGGAGTACAGG - Intronic
1198229240 X:134673736-134673758 TCCATCTGTTGAGGGAGGAAAGG + Intronic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200477629 Y:3659756-3659778 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1200548593 Y:4550271-4550293 TCCCTAAGTGGTGGGATTACAGG + Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202026255 Y:20527194-20527216 TCCCCAAGTTCTGGGAGTACAGG - Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic