ID: 1103380802

View in Genome Browser
Species Human (GRCh38)
Location 12:120492830-120492852
Sequence ACTTCAGGGGGACCTGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103380795_1103380802 -10 Left 1103380795 12:120492817-120492839 CCCCATATGGGCCACTTCAGGGG 0: 1
1: 0
2: 0
3: 22
4: 141
Right 1103380802 12:120492830-120492852 ACTTCAGGGGGACCTGGTGAAGG 0: 1
1: 0
2: 1
3: 16
4: 204
1103380790_1103380802 13 Left 1103380790 12:120492794-120492816 CCAAAATGTGTGATGCTACAGAA 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1103380802 12:120492830-120492852 ACTTCAGGGGGACCTGGTGAAGG 0: 1
1: 0
2: 1
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103380802 Original CRISPR ACTTCAGGGGGACCTGGTGA AGG Intronic
900380649 1:2382244-2382266 GATTCAGGAGGACCTGGTCAGGG - Intronic
900984689 1:6066492-6066514 GTTTCAGGGGGAGATGGTGAGGG + Intronic
901055833 1:6448317-6448339 ACGCCAGGGGGAGCTGGCGAAGG - Intronic
901198970 1:7456104-7456126 AATGCAGGCAGACCTGGTGAAGG + Intronic
901221672 1:7587032-7587054 CCTTCTGGGGGAGCTGGTGGTGG - Intronic
901636751 1:10674122-10674144 AGTGCAGGGGCACCTGGGGAGGG - Intronic
901640487 1:10690666-10690688 ACTGCAGGGGGTGCCGGTGAGGG - Intronic
902220159 1:14959479-14959501 ATCTCAGAGGGACCTGGGGAGGG - Intronic
902365403 1:15969798-15969820 ACTCCAGGGGAAGCTGGGGAGGG - Intronic
904629513 1:31830463-31830485 GCTTCAGAGGGTCCTGGTGCTGG - Intergenic
905011217 1:34748166-34748188 ACCTCAGGGTGTCCAGGTGAAGG - Intronic
905781965 1:40719463-40719485 ACTTTCTGGGGGCCTGGTGATGG - Intronic
906198200 1:43942711-43942733 ACTTCAGGTGGACTTGGGGAGGG + Intergenic
906453186 1:45970245-45970267 ACTCCAGGGGGATCTAGTCATGG - Intronic
907811650 1:57876879-57876901 ACTTCAGGTGGTCCTAGTAATGG + Intronic
908793335 1:67804813-67804835 ACTTCAGGGGAATCTAGTAATGG + Intronic
910201981 1:84709073-84709095 ACTTGAGGGTGGCTTGGTGATGG + Intergenic
915347635 1:155206046-155206068 ACATCAGGGGCACCTGGTATGGG - Intronic
916395515 1:164382587-164382609 CCTGCAGGGAGACCTGCTGATGG + Intergenic
920232725 1:204481207-204481229 TCTTCTGGGAGAGCTGGTGAGGG - Intronic
923023475 1:230185813-230185835 ACTCCAGGGGGACCCAGTCATGG - Intronic
923378648 1:233392360-233392382 ACTTCAGAGTGACTTGGTAAAGG - Intergenic
924140622 1:241019098-241019120 ACTCCTGGGGGCCCTGGTCATGG - Intronic
1062777794 10:168906-168928 ACTTCAGAGGGACCCAGTCACGG + Intronic
1064018608 10:11791768-11791790 ACTTCTTGGGAACCTGGGGAAGG + Intergenic
1065038278 10:21663202-21663224 CCTCCAGGGGGACCTGGTCTTGG - Intronic
1066107857 10:32171313-32171335 ACTTAATGAGGACCGGGTGAGGG - Intergenic
1067543240 10:47172937-47172959 ATTTCAGTGGGGCTTGGTGAGGG - Intergenic
1069827763 10:71264783-71264805 ACTCCAGGTGGTCCTGGTGCAGG + Intronic
1070694349 10:78551065-78551087 ACTGGAAGGGGACCTGGTGATGG - Intergenic
1072691729 10:97576474-97576496 CTTTCAGGGGAACTTGGTGATGG - Intronic
1074720844 10:116263847-116263869 ATTTCAGCAGGACTTGGTGATGG + Intronic
1075346483 10:121685755-121685777 TCTTCAGGGGACCCTGGTGCAGG + Intergenic
1076350560 10:129812083-129812105 GCTTCGGGAGGACCTGGTTATGG + Intergenic
1077337898 11:2013640-2013662 ACAGCAGGGCGACTTGGTGAAGG - Intergenic
1079400080 11:20099683-20099705 ACTTCAGTGGTACCAGGGGAAGG + Intronic
1081677801 11:44981059-44981081 GCTCCTGGGGGAGCTGGTGAGGG + Intergenic
1083401560 11:62426658-62426680 GCTTTAGGATGACCTGGTGAAGG - Intergenic
1084593744 11:70105185-70105207 ACTTCGGGGAGAGCTGGGGAGGG - Intronic
1087622218 11:100555189-100555211 GCTTCAGGGGGAAGGGGTGAGGG - Intergenic
1089778440 11:120855994-120856016 AGTTCAGGGGGACCAGGAAAAGG + Intronic
1090039635 11:123279278-123279300 ACTTAAGAGGGACCTATTGAAGG + Intergenic
1090481695 11:127074558-127074580 ACCTCAGGGAGACATGGGGAGGG - Intergenic
1091283285 11:134394435-134394457 TCTGCAGGGGGACGTGGTGTGGG - Intronic
1202820882 11_KI270721v1_random:68822-68844 ACAGCAGGGCGACTTGGTGAAGG - Intergenic
1091642649 12:2249228-2249250 ACTTCACTGGGTCATGGTGAGGG + Intronic
1092680085 12:10969199-10969221 ACTTCAGAGGGACAGGTTGAAGG - Intronic
1094285006 12:28783013-28783035 ACCCCATGAGGACCTGGTGAGGG - Intergenic
1097689971 12:62725687-62725709 TCTTATGGGGGACCTTGTGATGG + Intronic
1098342902 12:69470358-69470380 ACTTCCGGGGGAGCGGGGGAGGG - Intronic
1099677024 12:85773880-85773902 TCTTCAGAGGGACCTTGAGAGGG + Intergenic
1100785533 12:98074023-98074045 ACTGCAGGGAGAGATGGTGAAGG - Intergenic
1101319247 12:103658783-103658805 ACTTGCTGGGGACATGGTGATGG + Intronic
1102626104 12:114236590-114236612 GCAGCAGGGGGACCTGGTCAGGG + Intergenic
1103380802 12:120492830-120492852 ACTTCAGGGGGACCTGGTGAAGG + Intronic
1104783763 12:131437100-131437122 ACAGCAGGGGGAGCAGGTGAGGG - Intergenic
1104831770 12:131757354-131757376 ACTTCGGGGGTGGCTGGTGAAGG + Intronic
1106754736 13:32811247-32811269 CCTGCAGGGGACCCTGGTGATGG - Intergenic
1107446486 13:40474174-40474196 ACTGCAGTGGGGCCTGGTGGTGG + Intergenic
1108798763 13:54067202-54067224 ACTTCAGAGGGACGTCTTGATGG + Intergenic
1111900310 13:94191795-94191817 TCTCCAAGGGGAACTGGTGAAGG + Intronic
1113422832 13:110183225-110183247 GCTCCAGGGGGGCCTGGTAAAGG + Exonic
1115377605 14:32694732-32694754 ACTTAAGGTGTGCCTGGTGATGG - Intronic
1115706982 14:36008919-36008941 TCCTCATGGGGACCTCGTGAGGG + Intergenic
1119291405 14:73498204-73498226 ACTTCAAGGGGACCGGGTCAGGG - Exonic
1119563815 14:75611802-75611824 ACTTCAGGGGGTAGTTGTGAGGG + Intronic
1122972887 14:105159458-105159480 ACCTCAGGGAGCCCTGGAGATGG - Intronic
1123059409 14:105587723-105587745 ACTTGAGGGCGTCCAGGTGAAGG + Intergenic
1123083740 14:105707954-105707976 ACTTGAGGGCGTCCAGGTGAAGG + Intergenic
1127996103 15:64153836-64153858 CCTTCATGGGTCCCTGGTGATGG + Intronic
1128128738 15:65211583-65211605 ACTGCAAGGGGACATGGGGAGGG - Intergenic
1128427026 15:67552415-67552437 ACTTCGTGGGGATCTTGTGATGG - Intronic
1129269635 15:74412631-74412653 ACATTAGGGGGAACTGGAGAAGG - Intronic
1129849988 15:78788257-78788279 GCTGCAGCGGGACCAGGTGAGGG + Exonic
1132096045 15:98985659-98985681 ACCTCAGTTGGTCCTGGTGAGGG - Intronic
1132372967 15:101310669-101310691 ACAGCAGAGGGACCTGGTGGCGG - Intronic
1132520594 16:386060-386082 ACTAGAGGGGGACCTGGGGAGGG - Intronic
1132677361 16:1126322-1126344 ACTCCATGGTCACCTGGTGAGGG + Intergenic
1133264386 16:4574774-4574796 ACTGCAGCGGGAAGTGGTGAGGG + Exonic
1134088054 16:11372146-11372168 GCTTCAGGGGACCCTGGGGAGGG - Exonic
1134358329 16:13505664-13505686 TCTTCAGGGGGACCTGGAAAGGG + Intergenic
1136184793 16:28581045-28581067 TCTACAGGGGCACCTGGTGGGGG - Exonic
1140077573 16:71715732-71715754 ACTTTAGGAGGCCCAGGTGAGGG + Intronic
1140125439 16:72114055-72114077 AATTCAGGGGGAGCTGCTGTGGG - Intronic
1142664146 17:1452411-1452433 ACTTCAAAAGGACTTGGTGAGGG + Intronic
1143056160 17:4163369-4163391 ACTTCAGAGGGGTCAGGTGACGG + Intronic
1143530968 17:7503163-7503185 TCTGCAGGAGGACCTGGTGAAGG + Exonic
1143940540 17:10536591-10536613 TCTTCAGAGGGAGCTGGTGGAGG - Exonic
1145228564 17:21152506-21152528 ACTTCAGTGGGACCCAGTCATGG + Intronic
1146568320 17:33932147-33932169 TCTGCAGGAGCACCTGGTGAAGG - Intronic
1148222934 17:45877048-45877070 ACATTAGGGGAACCTGGTAATGG + Intergenic
1150638311 17:66932088-66932110 GCTGCAGGGTGAGCTGGTGAAGG - Intergenic
1151181828 17:72334723-72334745 ACTGCTGGAGGACTTGGTGATGG + Intergenic
1152660846 17:81541234-81541256 ACTAGAGGGGGGCCTGGCGATGG + Intronic
1154205992 18:12337460-12337482 ACGTCAGGGGGACATGGTATTGG - Exonic
1155908357 18:31479191-31479213 ACTTCAGGTGGACATAGTGCAGG + Intergenic
1156713527 18:39977437-39977459 ACTTCAGAGGGACATCTTGATGG - Intergenic
1158543098 18:58374539-58374561 CCTGCACGGGGACCTTGTGATGG + Intronic
1159907360 18:74107665-74107687 ACTTCAGGGGGACCCAGTCAAGG + Intronic
1160516683 18:79482803-79482825 ACTTCAGCGTGACCTGGTCCGGG + Intronic
1160596129 18:79975642-79975664 ACTTCAGGAACACCTGGTGTGGG + Intronic
1160733954 19:653355-653377 GCTCTAGGGGGACCTGGGGATGG - Intronic
1161038694 19:2098825-2098847 ACTTCAGGGGGAGGGGGTAAAGG + Intronic
1161691106 19:5734823-5734845 ACATCAGCGGGTCTTGGTGATGG + Intronic
1162566611 19:11448343-11448365 ACTCCCAGGGGAGCTGGTGATGG + Intronic
1163252274 19:16133063-16133085 ACTTCAGGAGGACCATGTGACGG - Exonic
1164533849 19:29069470-29069492 ACTCCAGAAGGACCTGGTCATGG + Intergenic
1164869475 19:31631361-31631383 ACTACAGGTTGGCCTGGTGAAGG + Intergenic
1165072113 19:33261549-33261571 ACTTAGGGGGGATCTGGTGCAGG + Intergenic
926720763 2:15958540-15958562 CCTTCAGGGGGCCCTGGAGCTGG - Intergenic
926800257 2:16653727-16653749 ATTTGACGGGGACCTGGGGAAGG + Intronic
927088733 2:19694536-19694558 ACTACAGATGGCCCTGGTGATGG - Intergenic
927421971 2:22943262-22943284 AGTGCAGGGGGGCCTGGAGAAGG + Intergenic
927871941 2:26629355-26629377 GCATCAGTGGGACCTGCTGATGG - Intronic
929205692 2:39289935-39289957 ACTTTAGCTGGACCTGGTGGTGG + Intronic
933099639 2:78236962-78236984 TCATGAGAGGGACCTGGTGAGGG - Intergenic
934515273 2:94982278-94982300 ACTTCCTGGGGACCTGGGAAGGG + Intergenic
934818230 2:97348682-97348704 AAATGAGGGGGACATGGTGAGGG + Intergenic
939966866 2:148618890-148618912 CATTTAGGGGGACATGGTGATGG - Intergenic
948010028 2:234645356-234645378 ACTACAGAAGGACATGGTGAGGG - Intergenic
1172354380 20:34269290-34269312 ACTTCAGGGAGACCTGGCTTGGG + Intronic
1175147146 20:56905419-56905441 ACTTCAGGTAGCCCTGGTGAAGG - Intergenic
1176098704 20:63355496-63355518 ACTGCAGGGTGCCCTGGAGAGGG - Intronic
1178436643 21:32565815-32565837 CGGTGAGGGGGACCTGGTGAGGG - Intergenic
1179063372 21:38001041-38001063 TCATCAGGGAAACCTGGTGAAGG - Intronic
1179629735 21:42668990-42669012 ACTTCAGGAGGGGATGGTGAAGG - Intronic
1179819375 21:43927857-43927879 CCTGCAGAGGGGCCTGGTGAGGG + Intronic
1180256705 21:46635012-46635034 ACTTCAGGGTCCCCTGGTAAAGG + Intergenic
1181596110 22:23915866-23915888 AATTCAGGGGAACCATGTGAGGG + Intergenic
1182128870 22:27836163-27836185 ACACCAGGGTGACCTAGTGAGGG - Intergenic
1183310281 22:37105892-37105914 ACTTCAGGAGGCCAAGGTGAGGG - Intronic
1183404326 22:37623039-37623061 CCTTCAGAAGCACCTGGTGAGGG + Intronic
1183571555 22:38656845-38656867 GCTTCAGGAGGGCCTGGGGAAGG + Intronic
1183667435 22:39253851-39253873 GCTGCAGGAGGACCTGGGGAAGG - Intergenic
1183742072 22:39674326-39674348 ACTTCAGGGAGATGTGGGGAGGG + Intronic
1184664705 22:45982145-45982167 ACTTCAAGGAGACCTGGGCAGGG - Intergenic
1184912407 22:47544965-47544987 CTTGCAGGGGGACCTGGGGAAGG + Intergenic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
950559536 3:13713747-13713769 AATTGAGGGGGACCTGTGGAGGG + Intergenic
951974409 3:28488138-28488160 ACTCCAGGGGGACCTAGTCATGG - Intronic
956478410 3:69648207-69648229 GCTTAAGGGGGAGCTGCTGAAGG - Intergenic
960563005 3:119106336-119106358 AGTTCGGGGGGAAATGGTGATGG - Intronic
961811783 3:129526272-129526294 ACCTCATGGAGCCCTGGTGATGG - Intergenic
962716565 3:138131178-138131200 ACTTCAGGGTGAACTGGTAGAGG + Exonic
962926606 3:139999411-139999433 ACTTCTGGGGAACCTGGGAATGG + Intronic
963858424 3:150280623-150280645 ACTTCAGAGGGACAGGTTGATGG + Intergenic
964852518 3:161110162-161110184 ACTTCAGGGGGACCTAGTCATGG + Intronic
965208405 3:165751556-165751578 ACTTCAGGGGGACAGCTTGACGG + Intergenic
968452169 4:680896-680918 ACTTCTGGGGGAGCCGCTGATGG - Intronic
971153856 4:24061957-24061979 ACTTCAGGAAGAAGTGGTGAAGG + Intergenic
972570827 4:40309209-40309231 CCTTCAGGGATTCCTGGTGATGG - Intergenic
973269688 4:48249934-48249956 ACTTCAGGGTGACTGGCTGATGG + Intronic
980093310 4:128464556-128464578 ACTCCAGGGGGAACTGGAGGAGG - Intergenic
991602417 5:68366859-68366881 GCTTCATAGGGTCCTGGTGAAGG + Intergenic
992217951 5:74544063-74544085 AATTCATGGGGACCTGATAAGGG - Intergenic
997505337 5:134412235-134412257 ACATCAGGGGGCCCGGGTCACGG + Intergenic
999343865 5:150797567-150797589 GCGTCAGGGGGAAATGGTGAAGG + Intergenic
999655203 5:153804231-153804253 ACATGAGAGGGACCTGGAGATGG - Intronic
1001499127 5:172215141-172215163 GCTCCATGGGGACTTGGTGAAGG + Intronic
1001528376 5:172445142-172445164 GCTTCTGGGGGACCTGGTCCTGG - Intronic
1001760974 5:174207833-174207855 AATTCAGGTGCACCTGGTAAGGG - Intronic
1002815371 6:675335-675357 ACTTTAGGGGGAACTGGCCATGG + Intronic
1004418751 6:15448805-15448827 AATTCACAGGCACCTGGTGATGG - Intronic
1004986399 6:21087877-21087899 ACTTCAGAGGGACAGGTTGATGG - Intronic
1007243367 6:40442785-40442807 ACTGCATGGGGCCCTGCTGAGGG + Intronic
1007416437 6:41694026-41694048 ACTTCAGTTGGCCCTGGTGGGGG + Intronic
1007505010 6:42328915-42328937 ACTTCCCGGAGACCTGGTCAGGG - Intronic
1007922844 6:45626385-45626407 ACCTCAGTGTGACCTGGCGAGGG + Intronic
1008919851 6:56831475-56831497 ATTTCAGTGGGAGCTGGGGAAGG - Intronic
1013171578 6:107640970-107640992 ATTTCAGGGGGAGTTGCTGAAGG - Intronic
1018389073 6:163329423-163329445 ACTGCAGGGGGAGTTGGGGAGGG - Intergenic
1018389091 6:163329481-163329503 ACTGCAGGGGGAGTTGGGGAGGG - Intergenic
1019083342 6:169451397-169451419 GCCTCAGGAGGTCCTGGTGATGG - Intergenic
1021610521 7:22453375-22453397 AGTTCAGGGGGAAATGCTGAGGG - Intronic
1022042118 7:26591138-26591160 ACTACAGAGGAACCTGGGGAGGG + Intergenic
1022389496 7:29930875-29930897 ACTTTAAAGGGACCTTGTGAGGG + Intronic
1023986968 7:45102425-45102447 CCTGCAGGTGGACCTGGTGTGGG - Exonic
1024782765 7:52870921-52870943 ACTTCAGGGGGATTTTGGGAGGG + Intergenic
1028924959 7:96347827-96347849 GCTTCAGTGGTTCCTGGTGAGGG + Intergenic
1029103429 7:98153475-98153497 TGTTCAGGGGGAAATGGTGATGG + Intronic
1031947193 7:127854462-127854484 ATTTCATGGGGACCTTGTAAAGG + Intronic
1032815025 7:135464528-135464550 ACTTGAGGGGGAAGTGGGGAGGG + Intronic
1033217518 7:139504157-139504179 ATTTCAGGAGGACCTGGATAGGG + Intergenic
1033682415 7:143607783-143607805 ATTTCAGTGGGGCCTGGGGAGGG - Intergenic
1033702474 7:143854130-143854152 ATTTCAGTGGGGCCTGGGGAGGG + Exonic
1033756117 7:144399259-144399281 TATTCAGGGGGACCTGGGCATGG - Intronic
1035036301 7:155897475-155897497 ACTTCTGGGAGGCCTGGAGAAGG - Intergenic
1041200727 8:55450609-55450631 ACTGCAGGTGGAGCTGGTGTAGG + Intronic
1041560806 8:59215716-59215738 ACTGGAGGGAGACCTGGTCATGG - Intergenic
1042185076 8:66128417-66128439 ACTTCAGAGGAACCTGCTGGTGG + Exonic
1043268954 8:78304478-78304500 AATTCAGTCGGACCTGGTGTGGG - Intergenic
1046130092 8:109955932-109955954 ACTCCAGGGGGACCCTGTCATGG - Intergenic
1046232175 8:111372608-111372630 TCTTGAGAGGGACCTGGTGGAGG + Intergenic
1047045330 8:121046819-121046841 ACTTCAAGGGGAGGTGGTCAGGG - Intergenic
1049837890 8:144750678-144750700 ACTCCAGGGGGACCCGGTCATGG - Intronic
1051134360 9:13901583-13901605 ACTTAAGTGGGGCTTGGTGAGGG - Intergenic
1052079105 9:24180744-24180766 ACATCAGGGGGACCTGGGCCTGG + Intergenic
1052862327 9:33444740-33444762 TGTTGAGGGGGACATGGTGAAGG - Intronic
1053449483 9:38181176-38181198 GCTTCCTGGGGACTTGGTGAGGG + Intergenic
1053538275 9:38947408-38947430 CTTTCTGGGGGACCTGGAGAAGG - Intergenic
1054627858 9:67416511-67416533 CTTTCTGGGGGACCTGGAGAAGG + Intergenic
1054804071 9:69381173-69381195 TCTTCCTGGGGACTTGGTGATGG + Intronic
1056525984 9:87443409-87443431 ATTGCAGGGGGGTCTGGTGAAGG + Intergenic
1057525500 9:95796049-95796071 AGGTCAGGGGGAACTGGTCAGGG - Intergenic
1058280094 9:103103387-103103409 ACTTCAGGGTGGCTTGGTGCAGG + Intergenic
1060402097 9:123355194-123355216 TCTTCAGGGGGACCTGGTTCAGG - Intergenic
1060666520 9:125435322-125435344 CCTTCAGAGGGACATGGTGAGGG - Intergenic
1060768682 9:126314524-126314546 GACTCAAGGGGACCTGGTGAAGG - Intergenic
1061821241 9:133228199-133228221 CCTTCGGGTGGACCTGGCGAGGG - Intergenic
1061834204 9:133318165-133318187 CCTTCGGGTGGACCTGGCGAGGG + Intergenic
1061957190 9:133969839-133969861 ACTACAGGGACACCTGGAGAGGG - Intronic
1062666228 9:137674237-137674259 CCTTCAGGAGGCCCTGGTGCAGG - Intronic
1186846976 X:13540508-13540530 ACTTAAGGGGAACCAGCTGATGG + Intergenic
1190992274 X:55564752-55564774 ACTTCATGGCCACCTGCTGATGG + Intergenic
1192158927 X:68768560-68768582 ACTTCAGGGGCAGCTGTTGAGGG - Intergenic
1196565074 X:117195729-117195751 TCATGAGAGGGACCTGGTGAGGG + Intergenic
1196940450 X:120770721-120770743 ACTTCTGGGGCACTTGGTCAGGG - Intergenic
1199643976 X:149887377-149887399 ACATGAGGGGGACCAGATGAAGG - Intergenic
1200092334 X:153641930-153641952 ACTGCAGGGGGACCTGGGGTGGG + Intergenic
1200911372 Y:8534307-8534329 ACTCCAGGGGGACCTGGCCATGG + Intergenic
1201755662 Y:17483330-17483352 ACTCCACGGTGAACTGGTGAGGG + Intergenic
1201845890 Y:18422655-18422677 ACTCCACGGTGAACTGGTGAGGG - Intergenic