ID: 1103381543

View in Genome Browser
Species Human (GRCh38)
Location 12:120497335-120497357
Sequence TCTCCCACCCTAAGAGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103381543_1103381549 23 Left 1103381543 12:120497335-120497357 CCAGTACCTCTTAGGGTGGGAGA 0: 1
1: 0
2: 1
3: 3
4: 94
Right 1103381549 12:120497381-120497403 ACTTGCTAACCTAGTGGACAGGG 0: 1
1: 0
2: 1
3: 3
4: 90
1103381543_1103381548 22 Left 1103381543 12:120497335-120497357 CCAGTACCTCTTAGGGTGGGAGA 0: 1
1: 0
2: 1
3: 3
4: 94
Right 1103381548 12:120497380-120497402 AACTTGCTAACCTAGTGGACAGG 0: 1
1: 0
2: 0
3: 2
4: 53
1103381543_1103381547 17 Left 1103381543 12:120497335-120497357 CCAGTACCTCTTAGGGTGGGAGA 0: 1
1: 0
2: 1
3: 3
4: 94
Right 1103381547 12:120497375-120497397 CCTACAACTTGCTAACCTAGTGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103381543 Original CRISPR TCTCCCACCCTAAGAGGTAC TGG (reversed) Intronic
900814431 1:4832586-4832608 TGGCCCAGCCTAAGAGGCACTGG + Intergenic
905199870 1:36308109-36308131 TCTCCCACCCTGAGGTCTACAGG + Exonic
913347917 1:117826577-117826599 TCTGCCACCCTGAGATCTACAGG + Intergenic
913374956 1:118140912-118140934 TCTCCCACTCTCAGTGCTACAGG + Intronic
921318691 1:213916631-213916653 TCTCCCACCATCACAGGCACTGG + Intergenic
1067482538 10:46613065-46613087 GCTCCTACCCTAACAGTTACTGG + Intergenic
1067612213 10:47728599-47728621 GCTCCTACCCTAACAGTTACTGG - Intergenic
1071627636 10:87188840-87188862 GCTCCTACCCTAACAGTTACTGG - Intronic
1075523028 10:123155261-123155283 TCTCCAACCCAAAACGGTACAGG - Intronic
1083799746 11:65039780-65039802 ACTCCCACCCTAACAGGGAGTGG + Exonic
1086622333 11:88902213-88902235 TCTTCCACCCTAAGTTATACTGG - Intronic
1087230014 11:95650553-95650575 TCAACCACTCTAAGAGGTAAGGG + Intergenic
1091322425 11:134661509-134661531 TTTCCCACCCCTAGAGCTACTGG + Intergenic
1091363840 11:135000668-135000690 TCTTCCACCCTAAAATATACGGG - Intergenic
1092089664 12:5794101-5794123 TCTCACACCCTCAGAGGTAAAGG + Intronic
1092779105 12:11968840-11968862 TCTCTCATCATAGGAGGTACTGG + Intergenic
1098971480 12:76861630-76861652 TCTTCCACCCTCAGAGTTTCTGG - Intronic
1099488180 12:83253533-83253555 TCTCTCACTCTGAGAGGTCCTGG - Intergenic
1103381543 12:120497335-120497357 TCTCCCACCCTAAGAGGTACTGG - Intronic
1103409345 12:120699781-120699803 CCTCCCTGCCTAAGAGCTACTGG + Exonic
1106934188 13:34700160-34700182 TCTCCAACACTAAGAGATATAGG - Intergenic
1113525560 13:110972090-110972112 TCTCCCACCCTCAAAGTTCCAGG + Intergenic
1121298379 14:92849009-92849031 TCTCCCTGCCTAAAAGCTACTGG - Intergenic
1121310521 14:92932988-92933010 TCTCCCACCCTGAGAGCCCCCGG - Intronic
1202829224 14_GL000009v2_random:8213-8235 TCTCCCACCTTAAGATTTAGTGG - Intergenic
1202900936 14_GL000194v1_random:38065-38087 TCTCCCACCTTAAGATTTAGTGG - Intergenic
1125001483 15:34775223-34775245 TCTTCCTCCCTAGCAGGTACTGG - Intergenic
1130966413 15:88700923-88700945 CCCCCCACCCCAAGAGGTATAGG + Intergenic
1133569462 16:7026674-7026696 TCACCCGACCTGAGAGGTACAGG - Intronic
1133838509 16:9387507-9387529 TCTCCCATCCCTAGAGGTTCAGG - Intergenic
1134821928 16:17253921-17253943 TCTGCCTCCCCAAGAGGGACAGG + Intronic
1135990446 16:27215791-27215813 TCTCCAACCCTTAGAGGCCCTGG - Intronic
1142443635 16:90119784-90119806 TCTCCCAACACAAGAGATACTGG + Intergenic
1153402163 18:4692906-4692928 TCTACCACCCAAAGAGGAATTGG + Intergenic
1155912466 18:31519884-31519906 TCTCCCTCCCGAAGAGCCACGGG - Exonic
1163610612 19:18299498-18299520 TCTCCCACCCTGGGAGGGAGAGG + Intergenic
1164267074 19:23629375-23629397 TATGCCACCTTTAGAGGTACTGG + Intronic
1167249522 19:48392788-48392810 TCTTCCACCCTCAGAGGCCCCGG + Intergenic
1202643472 1_KI270706v1_random:119576-119598 TCTCCCACCTTAAGATTTAGTGG + Intergenic
926579504 2:14619214-14619236 TCCCCCACCCAGAGAGCTACTGG + Intergenic
930683414 2:54282231-54282253 TCTCTAACCCTAACAGATACAGG - Intronic
930945509 2:57068860-57068882 TTACCCTCCCTAAGATGTACTGG - Intergenic
934505854 2:94893035-94893057 TCTCCCACCTTAAGATTTAGTGG + Intergenic
937382597 2:121394114-121394136 TCTCCCACCCTTAGAGTGAGCGG + Intronic
943611856 2:190044283-190044305 TCTCCAACCCAGAGAGATACAGG + Intronic
944879226 2:203994482-203994504 TTTCCCACCCTGAGAAGTTCTGG - Intergenic
945054213 2:205854174-205854196 CCATCCACCCTCAGAGGTACAGG + Intergenic
948692070 2:239712311-239712333 TCTCCCACATTAAGAGGGAGGGG + Intergenic
1171893441 20:30738515-30738537 TCTCCCACCTTAAGATTTAGTGG + Intergenic
1172272203 20:33660964-33660986 TCTGCCACCCTGAGAGGGGCTGG - Intronic
1176080133 20:63268356-63268378 TCACCCAAACTAAGAGGTGCTGG + Intronic
1176608408 21:8853053-8853075 TCTCCCACCTTAAGATTTAGTGG - Intergenic
1176620310 21:9052843-9052865 TCTCCCACCTTAAGATTTAGTGG - Intergenic
1180358491 22:11862857-11862879 TCTCCCACCTTAAGATTTAGTGG - Intergenic
1180379771 22:12129473-12129495 TCTCCCACCTTAAGATTTAGTGG + Intergenic
950484036 3:13262350-13262372 GCTCCTACCCTAAGAGGGACGGG - Intergenic
950943292 3:16916896-16916918 TCCTCCACCCTTTGAGGTACAGG - Intronic
953401666 3:42627434-42627456 TCCCCCACCAGAAGATGTACAGG - Intronic
954116603 3:48470063-48470085 TGTCCCACCCTCAGAGGCATGGG + Intronic
962398490 3:135037987-135038009 TCTCCCAACCTAAGAGCCGCAGG + Intronic
973150899 4:46887219-46887241 TATCCCACCCTAAAGGGTATGGG + Intronic
977314859 4:95433099-95433121 TCTGCCACACTGACAGGTACTGG + Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
983706245 4:170663622-170663644 ACTACCACCCTAAGAAGTACAGG + Intergenic
1202770842 4_GL000008v2_random:205490-205512 TCTCCCACCTTAAGATTTAGTGG + Intergenic
994692697 5:103037478-103037500 TCTCCCACCCTAAGAGAATTTGG + Intergenic
995794524 5:115927563-115927585 TCCCCAACCCTAAGAGAGACTGG - Intergenic
1001302776 5:170548922-170548944 TCTCCCATCTAAAGAGGTTCAGG - Intronic
1007677691 6:43611113-43611135 TCTCCCAGAGTAACAGGTACTGG - Intronic
1008440967 6:51531551-51531573 CCTCCCACCCTAACATGAACAGG + Intergenic
1013463040 6:110393777-110393799 TCTCCCTAACTAAAAGGTACAGG + Intronic
1019251887 7:18831-18853 TCTCCCAACACAAGAGATACTGG - Intergenic
1019652137 7:2165726-2165748 TCCCCATCCCCAAGAGGTACAGG + Intronic
1021487660 7:21184473-21184495 TCTCCCACCCTGAGAGGTAGGGG + Intergenic
1022400296 7:30029717-30029739 TCACCCACTCTAAGGGATACTGG - Intronic
1026396688 7:69962310-69962332 TCTCTGCTCCTAAGAGGTACAGG - Intronic
1029690058 7:102175361-102175383 TCTTCCACCCTGAGGGGTGCTGG - Intronic
1041580381 8:59452121-59452143 TCTCCCACTTTTAAAGGTACTGG + Intergenic
1042995944 8:74698768-74698790 TCCCACCCCCTAAGAGGCACTGG - Intronic
1043229817 8:77787990-77788012 GCTCCAACCCCGAGAGGTACAGG + Intergenic
1043823413 8:84896148-84896170 TCTCTCACACTCAGAGGTGCAGG + Intronic
1045890516 8:107151107-107151129 TCTCCCACTCCAAGAAGTTCTGG + Intergenic
1053578682 9:39380061-39380083 TCTCCCAGCCTTGGAGGTGCTGG + Intergenic
1053843204 9:42208140-42208162 TCTCCCAGCCTTGGAGGTGCTGG + Intergenic
1054100265 9:60938865-60938887 TCTCCCAGCCTTGGAGGTGCTGG + Intergenic
1054121662 9:61214492-61214514 TCTCCCAGCCTTGGAGGTGCTGG + Intergenic
1054355197 9:64054197-64054219 TCTCCCACCTTAAGATTTAGTGG - Intergenic
1054586080 9:66968017-66968039 TCTCCCAGCCTTGGAGGTGCTGG - Intergenic
1062748625 9:138234778-138234800 TCTCCCAACACAAGAGATACTGG + Intergenic
1203743524 Un_GL000218v1:23302-23324 TCTCCCACCTTAAGATTTAGTGG - Intergenic
1203703807 Un_KI270742v1:18263-18285 TCTCCCACCTTAAGATTTAGTGG - Intergenic
1203566588 Un_KI270744v1:96217-96239 TCTCCCACCTTAAGATTTAGTGG + Intergenic
1187855875 X:23636047-23636069 TCTCCCACCCTCAGACATCCTGG + Intergenic
1188387214 X:29575757-29575779 GCTATCACCCTAACAGGTACAGG - Intronic
1188427171 X:30062352-30062374 TCCCCAACCTTAAGAGGGACTGG + Intergenic
1190543552 X:51501955-51501977 CCTCCCTCCCTAAGAGTTAATGG - Intergenic
1192258350 X:69485532-69485554 TCTTCCACCCAAAGAGGTCATGG + Intergenic
1193252742 X:79310886-79310908 TCTCCCGGCCTAAAAGGTCCCGG - Intergenic
1201947450 Y:19527045-19527067 TCACACACCTTAAGAGGGACTGG + Intergenic