ID: 1103383843

View in Genome Browser
Species Human (GRCh38)
Location 12:120516095-120516117
Sequence CTTTCTTTACAGGAGATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103383836_1103383843 26 Left 1103383836 12:120516046-120516068 CCCAAAGTTCTGAGATTATAGGT 0: 13
1: 889
2: 17372
3: 135132
4: 346405
Right 1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 21
4: 226
1103383834_1103383843 29 Left 1103383834 12:120516043-120516065 CCTCCCAAAGTTCTGAGATTATA 0: 31
1: 2961
2: 55630
3: 357053
4: 247256
Right 1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 21
4: 226
1103383840_1103383843 -2 Left 1103383840 12:120516074-120516096 CCATGGGCTCAGCCAGAAGTTCT 0: 1
1: 0
2: 3
3: 29
4: 238
Right 1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 21
4: 226
1103383837_1103383843 25 Left 1103383837 12:120516047-120516069 CCAAAGTTCTGAGATTATAGGTG 0: 10
1: 824
2: 15151
3: 110163
4: 247350
Right 1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 21
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103383843 Original CRISPR CTTTCTTTACAGGAGATGAG AGG Intronic
900899479 1:5507039-5507061 CTTTCTTTCCAGGGGAGGGGGGG - Intergenic
905369642 1:37476206-37476228 CTCACATTACAGGAGAGGAGTGG - Intronic
905637542 1:39564882-39564904 CTTTCTATTCAAGAGCTGAGGGG + Intronic
906896554 1:49779479-49779501 CTTTCTGTAGAGGAAAGGAGAGG + Intronic
907187099 1:52617902-52617924 CTTTGTTTCCTGGAGTTGAGAGG - Intergenic
907469476 1:54664014-54664036 CTTTATTTAAGGGAGTTGAGGGG - Intronic
908646826 1:66287515-66287537 CCTGCTTTAAAGGAGCTGAGAGG + Intronic
908840955 1:68279683-68279705 CTATCTTAACAGGAGAAGAAGGG + Intergenic
909537064 1:76749141-76749163 CGTTCTCTACTAGAGATGAGGGG + Intergenic
910449684 1:87332263-87332285 CTGTCTTTCCTGGAGATGGGGGG + Intronic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
913351210 1:117861854-117861876 CCTTCTTTAGAGGACATAAGTGG + Intergenic
914658221 1:149763109-149763131 CCTTCTACACAGGCGATGAGGGG - Intergenic
915399083 1:155609552-155609574 CTTTCTTTAGAATAGATCAGTGG + Intergenic
917559611 1:176135076-176135098 TTTTATTTTCAGGAAATGAGTGG - Exonic
919746118 1:201010210-201010232 CTTCCTTTCCAGGAGTTGGGCGG + Intronic
921804112 1:219434778-219434800 CTTGCGTTACAGGAGATCGGAGG + Intergenic
922821677 1:228488948-228488970 TTTTCTTTACAGGAGAACAAGGG + Exonic
923324894 1:232872002-232872024 CTCTCTTTCCAGGAAATGAGAGG - Intergenic
924584272 1:245348186-245348208 ATTTATTTAGAGCAGATGAGAGG - Intronic
1064228922 10:13512565-13512587 TTTTCTGTACAGGAGAGCAGAGG - Intronic
1066482792 10:35813086-35813108 TTATTTTTTCAGGAGATGAGGGG + Intergenic
1068030363 10:51698405-51698427 CCTTCCTCACATGAGATGAGGGG - Exonic
1072027327 10:91474182-91474204 CTTTCTTAACTGGAGAGTAGGGG + Intronic
1072724139 10:97801211-97801233 CTTTCTGCACAGGAGCTGTGTGG - Intergenic
1073133524 10:101206241-101206263 GTTTCTTCACAGCAGATGTGAGG + Intergenic
1073301202 10:102471931-102471953 CTCACTTTACAGGAGAGGACAGG - Intronic
1074611930 10:115030154-115030176 CTTTCTCCTCAGGTGATGAGTGG + Intergenic
1075699719 10:124461648-124461670 CTTTCTTCCCAGGAGATCAGCGG - Intergenic
1076498553 10:130915933-130915955 GCTTGTTTGCAGGAGATGAGGGG + Intergenic
1077811363 11:5641155-5641177 TTTTCTTTCTAGGACATGAGTGG + Exonic
1077902867 11:6503939-6503961 ATTTCTATATATGAGATGAGTGG + Intronic
1080699385 11:34631584-34631606 ATCTCTTGGCAGGAGATGAGTGG + Intronic
1080908219 11:36568202-36568224 TTTTCCTTCCAGGTGATGAGGGG + Intronic
1081850338 11:46271318-46271340 CTTTCTTTACTTGAGCTGTGAGG - Intergenic
1083853626 11:65381427-65381449 CTGTCTTTATAAGAAATGAGAGG - Intronic
1084931648 11:72561084-72561106 ATTTCTTTTGAGGAGAAGAGAGG + Intergenic
1087414112 11:97830822-97830844 CTTTCTTTCTAGGAGAAGAGAGG - Intergenic
1089654114 11:119934707-119934729 CTTCATTTCCATGAGATGAGGGG + Intergenic
1091409422 12:229400-229422 CTATCTTTGCAGGAGCTGTGTGG - Intronic
1092660256 12:10731149-10731171 TTTTGTTTGCAGGAAATGAGAGG - Intergenic
1097472029 12:60005406-60005428 CTTTATTTACATGAGATCATAGG + Intergenic
1099589223 12:84566015-84566037 ATTTCTTTACAGCAGATAGGAGG - Intergenic
1099623631 12:85036805-85036827 CTTTCTTTACAGGGGTTGAAGGG + Intronic
1099841994 12:87977507-87977529 CTTTGTTTACTGTAGATGAAAGG + Intergenic
1102837455 12:116078585-116078607 CTTTATTTACAAGAAATGGGTGG - Intronic
1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106597022 13:31152922-31152944 CCTTCTTTACAGATGCTGAGAGG - Exonic
1107268675 13:38588600-38588622 CTTTCTATACTGTAGATGTGTGG - Intergenic
1108898055 13:55360080-55360102 ATTACTTTACAGAAGAAGAGAGG - Intergenic
1109132562 13:58606376-58606398 TTTTCTTCACAGAAAATGAGAGG + Intergenic
1109450487 13:62507630-62507652 CTTTCATTAAAGGAGAAAAGAGG - Intergenic
1112121951 13:96422708-96422730 CCTCATTTACAGGAGAGGAGTGG - Intronic
1113761702 13:112852588-112852610 CTGTCTGTCCAGGAGAAGAGGGG + Intronic
1115454735 14:33589040-33589062 ATTTCTTTACAAGAGATTAGAGG - Intronic
1116079278 14:40153383-40153405 GTTCCTTTACAGGGGATGATTGG - Intergenic
1116131473 14:40859809-40859831 CTATTTTTACAGGATATCAGGGG - Intergenic
1117460773 14:55942669-55942691 CTTTGTCTACTGGAGATGGGAGG - Intergenic
1122799843 14:104224008-104224030 CTTTATTCACAAGAGAGGAGAGG - Intergenic
1123133626 14:106007825-106007847 CTTTCTTTCCTGGTGAAGAGGGG - Intergenic
1123583648 15:21738257-21738279 CTTTCTTTCCTGGTGAAGAGGGG - Intergenic
1123620298 15:22180860-22180882 CTTTCTTTCCTGGTGAAGAGGGG - Intergenic
1123857181 15:24426222-24426244 CTTTCTGTCCAGGACATGTGTGG + Intergenic
1123861812 15:24476750-24476772 CTTTCTGTCCAGGACATGTGTGG + Intergenic
1124176965 15:27435436-27435458 CTTTATTTACAAAAAATGAGTGG + Intronic
1125399456 15:39284935-39284957 CTTTCTTCACTAGAGATGAGTGG - Intergenic
1126545140 15:49865115-49865137 CTTCCCTTCCAGGAGATTAGAGG - Intronic
1128936700 15:71752541-71752563 CTTATTTTAGAGTAGATGAGTGG + Intronic
1129816558 15:78559854-78559876 CTTTCTATTCTGGACATGAGAGG - Intergenic
1130454272 15:84089604-84089626 CTTTTTTTAAAGATGATGAGGGG - Intergenic
1130799156 15:87243522-87243544 CTTTCCCTAAAGGAGAAGAGAGG + Intergenic
1130898423 15:88188731-88188753 ATTTCTTGAGAGGAAATGAGGGG + Intronic
1131553275 15:93375972-93375994 TTTTCTTTACAGGGAAGGAGAGG + Intergenic
1132065833 15:98730184-98730206 CTTTCTTTCCAAGAGAGGTGAGG - Intronic
1133571507 16:7045050-7045072 CTTTCTTCACGGAAGATGTGAGG + Intronic
1135718739 16:24795895-24795917 CTTTCCTTACAGGGTCTGAGTGG + Exonic
1138490676 16:57374429-57374451 CTTTCTTGCCAGGACTTGAGTGG - Intronic
1139195749 16:64917066-64917088 ATTTTCTTACAAGAGATGAGGGG + Intergenic
1139514946 16:67447321-67447343 CCTCTTTTTCAGGAGATGAGAGG + Intronic
1139795789 16:69482015-69482037 CTATCTTTACAGGAAACCAGGGG - Intergenic
1141165250 16:81656040-81656062 TTTTCTTTAGTGGATATGAGTGG - Intronic
1142207459 16:88790959-88790981 CTTGCTTTACAGGCGAGGAGGGG - Intergenic
1148566073 17:48633760-48633782 CTTTCTTTTCAGGACAGGAGGGG - Intergenic
1149655979 17:58309782-58309804 CTTTCTTTCCAGGAGGGCAGGGG + Intronic
1149667019 17:58372034-58372056 CTTTCTTGCCAGGATATGTGGGG - Intronic
1150211149 17:63442193-63442215 TGTGCTTTACAGGAGATAAGCGG + Intronic
1151130885 17:71894938-71894960 CTTCCTTTGCAGGGGAAGAGGGG - Intergenic
1151776768 17:76209672-76209694 CTATCTTTACATCAGATGAAAGG + Intronic
1153095506 18:1397335-1397357 GTTTATTTAAAGGATATGAGAGG - Intergenic
1155041510 18:22069155-22069177 ATTTCTTAAAAGGAGATGGGAGG - Intergenic
1156256291 18:35399907-35399929 CTTTCTTTTCAGGATATGAGTGG - Intergenic
1157261948 18:46183404-46183426 CTTCTTTTGCAGGGGATGAGGGG + Intronic
1158392397 18:57054006-57054028 CTGTCTGTGCAGGAGATGAGGGG + Intergenic
1158918748 18:62165501-62165523 ATTTCCTTACAGGATATGGGGGG + Intronic
1160032219 18:75271943-75271965 CATTCTTTACAGGAAGCGAGCGG - Intronic
1160841366 19:1148242-1148264 CTTTCTATGCAGGAGGAGAGTGG - Intronic
1161057887 19:2199806-2199828 CTTTCTTCACAGGGGCTGGGCGG + Intronic
1162154130 19:8665080-8665102 CTGTCTATTCAGGAGATGTGTGG + Intergenic
1163088762 19:15003357-15003379 CTGCCTTTGCAGGAGATGACAGG + Intronic
1165064342 19:33220241-33220263 CTTTGGAGACAGGAGATGAGCGG + Intronic
1165681291 19:37778539-37778561 CTTTCTTTCCAGTAGATGTTGGG - Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1168161973 19:54516449-54516471 CTGACTATACAGGAGATGATGGG + Intergenic
1168231767 19:55037093-55037115 GTTGCATTACTGGAGATGAGAGG - Intronic
926708456 2:15855046-15855068 ATTTCTTTACATGAGATGATTGG + Intergenic
928259947 2:29757457-29757479 CCTTCCTTACAGGACATGAAAGG - Intronic
928902573 2:36336168-36336190 CTTTCCTTAAGGGAGATCAGGGG - Intergenic
930391682 2:50769325-50769347 GTTTCTTTGCTGGAGATTAGGGG - Intronic
931169744 2:59790337-59790359 CTTGCTGGACAGGTGATGAGAGG - Intergenic
931679327 2:64730677-64730699 TGTTGTTTACAGGAGAAGAGAGG + Intronic
933999427 2:87695126-87695148 CTTTCTTTAGAGCTGAGGAGAGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935279952 2:101508326-101508348 CTTTATTTAAAGTAGAGGAGAGG - Intergenic
935828336 2:106973736-106973758 CTTTTTCTTCAGCAGATGAGGGG + Intergenic
936294427 2:111255765-111255787 CTTTCTTTAGAGCTGAGGAGAGG - Intergenic
936599673 2:113883509-113883531 CATTCTTTACAGGCAGTGAGGGG + Intergenic
937359977 2:121222820-121222842 CCTTCTTTAGAGGAGAAGCGGGG - Exonic
937796683 2:126030915-126030937 CTTTCTTCAAAGAAGATGAAAGG + Intergenic
938081874 2:128374515-128374537 CTTTTCTTCCAGGAGATGATGGG + Intergenic
941142242 2:161799436-161799458 TATTCTTTACAGGACCTGAGGGG + Intronic
942345281 2:174996525-174996547 ATTTCTTTACAGGTAATCAGGGG - Intronic
942495291 2:176533819-176533841 CTTTCTTTGCAGGAAATGAAGGG - Intergenic
944092139 2:195923651-195923673 TTTTTTTTACAAGTGATGAGAGG + Exonic
944649907 2:201819476-201819498 TTTACTCTGCAGGAGATGAGAGG + Intronic
1169907550 20:10618674-10618696 CATTCTTTACAAGACATGATGGG + Intronic
1171338653 20:24409969-24409991 GGTTCTTTACTAGAGATGAGGGG + Intergenic
1173941526 20:46915006-46915028 TTTTCTCTACCGGAGATGGGAGG + Intronic
1174391297 20:50219929-50219951 CATTCTTAACAGGACATGTGAGG - Intergenic
1175876108 20:62230947-62230969 CTGTCTTTGCAGGACATGATGGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181089794 22:20464811-20464833 CTTTGTCTTCAGGTGATGAGAGG - Intronic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183132187 22:35849181-35849203 CTTTGTTTTGAGCAGATGAGAGG - Intronic
1184523376 22:45008379-45008401 CTTTCTTTCCAGGAAAGGGGAGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949978133 3:9479320-9479342 CTTTATTTACAGGAAACAAGTGG + Intergenic
950666724 3:14500474-14500496 TTTTCTTTCCAGGAGATTTGAGG - Intronic
950983314 3:17332236-17332258 GTTAATTTACAGGAGATGAAAGG + Intronic
952794276 3:37225072-37225094 CTTTCTTAACAGGCTATGATTGG + Intergenic
953152639 3:40339079-40339101 GTTTCATTACAGGAAAAGAGGGG - Intergenic
953208425 3:40852622-40852644 GTTTCTTAACAGGAGTGGAGAGG + Intergenic
954819516 3:53313467-53313489 CTTTCTTTACAAGGGAGAAGGGG - Intronic
957239930 3:77646044-77646066 CTTTCTTTAGAGTAAATGAGAGG + Exonic
960600344 3:119451068-119451090 CTTTCTTTAGAGGATCTCAGTGG - Intronic
962016559 3:131446729-131446751 ATTTTTATATAGGAGATGAGAGG + Intergenic
962360021 3:134732142-134732164 GTTTCTTTACAGATGATGAGAGG - Intronic
962552385 3:136508269-136508291 CTTTATTTAAAGGAGATTATAGG - Intronic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
964307647 3:155357885-155357907 CTTTCTTTCCTGGAGATTAGGGG - Intergenic
965326764 3:167314926-167314948 CTTTCTGTTCAGCAGATAAGAGG - Intronic
965986009 3:174753915-174753937 CTTTCTCTTCTTGAGATGAGAGG + Intronic
966191984 3:177279861-177279883 CTGGCTTTACAGGTGATGAATGG + Intergenic
971130694 4:23806428-23806450 ATTTCTAAACAGGAGATGAAAGG + Intronic
972978202 4:44663437-44663459 CTTTCTTAACAGGTGAACAGTGG - Intronic
973157034 4:46968461-46968483 CTGTCTTCACAGGAGGTGTGGGG - Intronic
973562245 4:52148867-52148889 CTTTCTTCTCAGGAGTTAAGGGG + Intergenic
974996248 4:69163405-69163427 CTTTCTTTAGAGGTAATGTGTGG + Intronic
975454654 4:74575900-74575922 CCTTCTTTACTGCAGATGTGTGG - Intergenic
976114481 4:81712337-81712359 CTTTCTTTAAAGGAATTAAGCGG + Intronic
977163226 4:93662634-93662656 CTGTCTTGAAAAGAGATGAGTGG + Intronic
977370957 4:96135065-96135087 CTTTCTTTACAGGTGTTGTCTGG + Intergenic
978562505 4:110048039-110048061 GTTTCTTTACATGAGCAGAGAGG + Exonic
979785227 4:124709547-124709569 TTTTCTTTAAAGGAGATTATTGG - Intronic
980974800 4:139600265-139600287 CTTTGTCTCCAGAAGATGAGAGG - Intronic
981420677 4:144546682-144546704 CTTTCTTTCCAGGGGGTGGGTGG + Intergenic
981918280 4:150058779-150058801 CCTTCTATAGAGGAGAAGAGTGG - Intergenic
986174831 5:5343191-5343213 CTTTCTTTACATGCCACGAGTGG + Intergenic
986210093 5:5663903-5663925 CTTTCAATGCAGGATATGAGTGG - Intergenic
987132675 5:14872679-14872701 CTTTATTTAAAAGAGATGATAGG - Intergenic
987401350 5:17480295-17480317 TTTTTTTTAAAGGAAATGAGTGG + Intergenic
987575373 5:19721631-19721653 CTTTCATTACAGTCGATGACAGG - Intronic
987586929 5:19867127-19867149 TTTTCTTTGCAGGAGGTGAGTGG - Intronic
987645225 5:20662579-20662601 CTTTCTTGCCAGGAAAAGAGAGG + Intergenic
989224172 5:39006661-39006683 TTTTCTTTAGAGGAAATAAGGGG + Intronic
990550094 5:56866996-56867018 TTTTATTTAGAAGAGATGAGGGG - Intronic
994217919 5:97159528-97159550 CTTCCTTTTGAGGAGAGGAGAGG - Intronic
994901893 5:105783678-105783700 CATTCTTTACAAAAAATGAGTGG + Intergenic
995519105 5:112983962-112983984 CTTCCTTCACAGGATATGTGAGG + Intronic
996912915 5:128676062-128676084 GTTTCTTTACAGAGGATGGGAGG - Intronic
996927563 5:128846246-128846268 CTTTCACTTCAGGAGAGGAGTGG + Intronic
997310130 5:132872880-132872902 CTTTCTTCCCAGTAGTTGAGTGG - Exonic
998968262 5:147563982-147564004 ATTTATTTATTGGAGATGAGGGG + Intergenic
1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG + Intergenic
1001816238 5:174671597-174671619 ATTTCTTTCAAGGAAATGAGTGG - Intergenic
1002115309 5:176957519-176957541 CATCCTTTACAGGAGATAGGAGG + Intronic
1002955421 6:1858244-1858266 CTTACTTTGCAAGAAATGAGGGG - Intronic
1004817444 6:19327733-19327755 ATTTCTTGAAAGAAGATGAGAGG + Intergenic
1004827282 6:19436778-19436800 TTTTCTCTGCATGAGATGAGAGG + Intergenic
1006253813 6:32813461-32813483 ATTTCTTTCCAGGATATGTGAGG - Exonic
1008446895 6:51602854-51602876 CTTACTTTATAGTATATGAGAGG + Intergenic
1011583477 6:88898523-88898545 CTTTCTTTAGAAGACAAGAGAGG - Intronic
1014377957 6:120700512-120700534 CTTTCTTTAGATGAGATTGGTGG + Intergenic
1015477963 6:133674720-133674742 CTTCCTTTAAAGCAGATGGGTGG - Intergenic
1016044504 6:139467312-139467334 TTTTCTTTTCTGGAGATGGGGGG + Intergenic
1017049401 6:150376374-150376396 CCTTCTTCATAGGGGATGAGGGG + Intronic
1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG + Intronic
1021144725 7:17070964-17070986 CTTTGGTTACTGGAGGTGAGAGG - Intergenic
1021185540 7:17560249-17560271 TTTTCCTTACAGGAAATGTGTGG - Intergenic
1021853684 7:24833023-24833045 TTTTCTTTAAAGGAAATGATTGG - Intronic
1022408408 7:30115222-30115244 CTTTCTTAAAAGAAGATGTGGGG - Intronic
1024370957 7:48583193-48583215 ATGTCTTTACAGAAGATAAGGGG - Intronic
1024626325 7:51211020-51211042 CTTTGTCCTCAGGAGATGAGAGG - Intronic
1028992424 7:97063422-97063444 CTTTCTTTAGAGGCTATGAGAGG + Intergenic
1029613961 7:101644782-101644804 CTTTCTCCACAGGGGAGGAGAGG + Intergenic
1031850398 7:126856001-126856023 CTTTCCTTAAAGGAGAAAAGTGG + Intronic
1032072536 7:128817451-128817473 CCTGCTTGACAGGATATGAGAGG + Intronic
1032075935 7:128836237-128836259 CTATCTTTTCAGGAGATGAGGGG - Intronic
1032416807 7:131741780-131741802 CCTTCATTTCAGGAGGTGAGAGG - Intergenic
1033511564 7:142064824-142064846 CTTTAGTTACAGGAGGTGAAGGG + Intronic
1037375116 8:18218847-18218869 TTTTCTTTAGTGGAGGTGAGGGG + Intronic
1037682553 8:21109636-21109658 TAATCTTCACAGGAGATGAGCGG - Intergenic
1039306096 8:36264661-36264683 CTTGCTTTAAATGAGATGAGAGG + Intergenic
1040003864 8:42601435-42601457 CTTTTTTCACAGGAGATTGGAGG + Intergenic
1040360783 8:46662227-46662249 CTTTCTCTCCAGGAGTTGTGCGG + Intergenic
1040744784 8:50628073-50628095 CTTTGTTTCCATGAGATGACTGG - Intronic
1042932315 8:74025682-74025704 CTTTCTTTAAAGCAGATAAAGGG - Intronic
1044168220 8:89016229-89016251 CTTTCTTTACTAGAGATGCTTGG - Intergenic
1045985803 8:108248605-108248627 CTCTCTGTAAAGGAGGTGAGGGG - Exonic
1047695839 8:127402835-127402857 CCTTCTTCACAGGACAAGAGAGG + Intergenic
1048980381 8:139700578-139700600 CTTTCTTTCCAGAAAATCAGTGG + Intronic
1051030640 9:12671641-12671663 CTTTCTATAAAGGAGATCACAGG + Intergenic
1052572946 9:30252142-30252164 CTTTCCTTAAAGGACATCAGAGG - Intergenic
1052874794 9:33549299-33549321 CTTTGTTTCCAGGAGATAAAAGG + Intronic
1053501228 9:38595020-38595042 CTTTGTTTCCAGGAGATAAAAGG - Intergenic
1054351616 9:64021381-64021403 CTCTCTTTGGAGGAGAAGAGGGG + Intergenic
1055212887 9:73819225-73819247 CTCTCTTTACAGAATAAGAGAGG + Intergenic
1056765174 9:89440580-89440602 CTTTTTTTCCAGGAGACCAGGGG - Intronic
1059324724 9:113497302-113497324 CTCTCGTGACAGGAGATCAGTGG + Exonic
1186448037 X:9648621-9648643 CTTCCTTCACAGAAGAGGAGGGG - Intronic
1186684809 X:11914671-11914693 CTTTCTCTGGAGGAGAAGAGAGG - Intergenic
1186976317 X:14909359-14909381 CTGACTTTAGAAGAGATGAGAGG - Intronic
1187090130 X:16087802-16087824 CTGTCTACACAGGAGATAAGTGG + Intergenic
1187213253 X:17250284-17250306 CTCTCATTACAGAAGCTGAGGGG + Intergenic
1188219929 X:27528764-27528786 GTTTATTTAAAGGTGATGAGAGG - Intergenic
1189745947 X:44168784-44168806 CTATCTTTGCAGGAGAAGATAGG + Intronic
1191913226 X:66173780-66173802 CCTCTTTTACAGGTGATGAGAGG - Exonic
1192841129 X:74857258-74857280 CTTCCTCTTCAGGAGAGGAGAGG + Intronic
1194185699 X:90772522-90772544 CTTTCAGTACAGGAGATGCAAGG - Intergenic
1194247523 X:91534482-91534504 CTTTCTTTTGAGGAGAGGAGAGG - Intergenic
1196507257 X:116462239-116462261 CTTTCCTTACAGGAAATGTAAGG - Intronic
1198373347 X:136013263-136013285 CTTTCTTCACAGTAGATTATAGG - Intronic
1200532317 Y:4354601-4354623 CTTTCAGTACAGGAGATGCAAGG - Intergenic
1200566546 Y:4776015-4776037 CTTTCTTTTGAGGAGAGGAGAGG - Intergenic
1201442251 Y:14021003-14021025 CTTTTTTTACAGGCAATCAGTGG + Intergenic
1201562310 Y:15331249-15331271 CCTACTCAACAGGAGATGAGAGG + Intergenic
1201776482 Y:17671381-17671403 CTGTTCTTACAGCAGATGAGAGG + Intergenic
1201825074 Y:18234611-18234633 CTGTTCTTACAGCAGATGAGAGG - Intergenic