ID: 1103393199

View in Genome Browser
Species Human (GRCh38)
Location 12:120589076-120589098
Sequence TCCGGGCCACACCAGTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393199_1103393206 -1 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393206 12:120589098-120589120 AGCCAAGGCAAGGCTGTGGCGGG No data
1103393199_1103393212 20 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG No data
1103393199_1103393205 -2 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393205 12:120589097-120589119 GAGCCAAGGCAAGGCTGTGGCGG No data
1103393199_1103393208 2 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393208 12:120589101-120589123 CAAGGCAAGGCTGTGGCGGGCGG No data
1103393199_1103393204 -5 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393204 12:120589094-120589116 CCGGAGCCAAGGCAAGGCTGTGG No data
1103393199_1103393209 3 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393209 12:120589102-120589124 AAGGCAAGGCTGTGGCGGGCGGG No data
1103393199_1103393210 6 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393210 12:120589105-120589127 GCAAGGCTGTGGCGGGCGGGCGG No data
1103393199_1103393211 19 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393211 12:120589118-120589140 GGGCGGGCGGCCTCCCAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393199 Original CRISPR TCCGGGCCACACCAGTCCTG TGG (reversed) Intergenic