ID: 1103393202

View in Genome Browser
Species Human (GRCh38)
Location 12:120589093-120589115
Sequence CACAGCCTTGCCTTGGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393202_1103393212 3 Left 1103393202 12:120589093-120589115 CCCGGAGCCAAGGCAAGGCTGTG No data
Right 1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG No data
1103393202_1103393211 2 Left 1103393202 12:120589093-120589115 CCCGGAGCCAAGGCAAGGCTGTG No data
Right 1103393211 12:120589118-120589140 GGGCGGGCGGCCTCCCAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393202 Original CRISPR CACAGCCTTGCCTTGGCTCC GGG (reversed) Intergenic