ID: 1103393203

View in Genome Browser
Species Human (GRCh38)
Location 12:120589094-120589116
Sequence CCACAGCCTTGCCTTGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393203_1103393211 1 Left 1103393203 12:120589094-120589116 CCGGAGCCAAGGCAAGGCTGTGG No data
Right 1103393211 12:120589118-120589140 GGGCGGGCGGCCTCCCAGTTCGG No data
1103393203_1103393212 2 Left 1103393203 12:120589094-120589116 CCGGAGCCAAGGCAAGGCTGTGG No data
Right 1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393203 Original CRISPR CCACAGCCTTGCCTTGGCTC CGG (reversed) Intergenic