ID: 1103393207

View in Genome Browser
Species Human (GRCh38)
Location 12:120589100-120589122
Sequence CGCCCGCCACAGCCTTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393207_1103393211 -5 Left 1103393207 12:120589100-120589122 CCAAGGCAAGGCTGTGGCGGGCG No data
Right 1103393211 12:120589118-120589140 GGGCGGGCGGCCTCCCAGTTCGG No data
1103393207_1103393212 -4 Left 1103393207 12:120589100-120589122 CCAAGGCAAGGCTGTGGCGGGCG No data
Right 1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG No data
1103393207_1103393218 30 Left 1103393207 12:120589100-120589122 CCAAGGCAAGGCTGTGGCGGGCG No data
Right 1103393218 12:120589153-120589175 GCGTTCCCACCGCTCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393207 Original CRISPR CGCCCGCCACAGCCTTGCCT TGG (reversed) Intergenic