ID: 1103393211

View in Genome Browser
Species Human (GRCh38)
Location 12:120589118-120589140
Sequence GGGCGGGCGGCCTCCCAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393207_1103393211 -5 Left 1103393207 12:120589100-120589122 CCAAGGCAAGGCTGTGGCGGGCG No data
Right 1103393211 12:120589118-120589140 GGGCGGGCGGCCTCCCAGTTCGG No data
1103393203_1103393211 1 Left 1103393203 12:120589094-120589116 CCGGAGCCAAGGCAAGGCTGTGG No data
Right 1103393211 12:120589118-120589140 GGGCGGGCGGCCTCCCAGTTCGG No data
1103393202_1103393211 2 Left 1103393202 12:120589093-120589115 CCCGGAGCCAAGGCAAGGCTGTG No data
Right 1103393211 12:120589118-120589140 GGGCGGGCGGCCTCCCAGTTCGG No data
1103393199_1103393211 19 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393211 12:120589118-120589140 GGGCGGGCGGCCTCCCAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393211 Original CRISPR GGGCGGGCGGCCTCCCAGTT CGG Intergenic