ID: 1103393212

View in Genome Browser
Species Human (GRCh38)
Location 12:120589119-120589141
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393207_1103393212 -4 Left 1103393207 12:120589100-120589122 CCAAGGCAAGGCTGTGGCGGGCG No data
Right 1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG No data
1103393203_1103393212 2 Left 1103393203 12:120589094-120589116 CCGGAGCCAAGGCAAGGCTGTGG No data
Right 1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG No data
1103393199_1103393212 20 Left 1103393199 12:120589076-120589098 CCACAGGACTGGTGTGGCCCGGA No data
Right 1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG No data
1103393202_1103393212 3 Left 1103393202 12:120589093-120589115 CCCGGAGCCAAGGCAAGGCTGTG No data
Right 1103393212 12:120589119-120589141 GGCGGGCGGCCTCCCAGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393212 Original CRISPR GGCGGGCGGCCTCCCAGTTC GGG Intergenic
No off target data available for this crispr