ID: 1103393644

View in Genome Browser
Species Human (GRCh38)
Location 12:120591657-120591679
Sequence TTAACTCAGCCCAGGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393641_1103393644 -9 Left 1103393641 12:120591643-120591665 CCTGGAGGAGGCACTTAACTCAG No data
Right 1103393644 12:120591657-120591679 TTAACTCAGCCCAGGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393644 Original CRISPR TTAACTCAGCCCAGGTGGTC AGG Intergenic
No off target data available for this crispr