ID: 1103393861

View in Genome Browser
Species Human (GRCh38)
Location 12:120593016-120593038
Sequence GCACATTCATCCCACTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393861_1103393868 28 Left 1103393861 12:120593016-120593038 CCTCATCAGTGGGATGAATGTGC No data
Right 1103393868 12:120593067-120593089 TGCCTTCTCTCCACCATGTGAGG No data
1103393861_1103393869 29 Left 1103393861 12:120593016-120593038 CCTCATCAGTGGGATGAATGTGC No data
Right 1103393869 12:120593068-120593090 GCCTTCTCTCCACCATGTGAGGG No data
1103393861_1103393871 30 Left 1103393861 12:120593016-120593038 CCTCATCAGTGGGATGAATGTGC No data
Right 1103393871 12:120593069-120593091 CCTTCTCTCCACCATGTGAGGGG No data
1103393861_1103393864 -5 Left 1103393861 12:120593016-120593038 CCTCATCAGTGGGATGAATGTGC No data
Right 1103393864 12:120593034-120593056 TGTGCTTAGAAAAGGGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393861 Original CRISPR GCACATTCATCCCACTGATG AGG (reversed) Intergenic
No off target data available for this crispr