ID: 1103393865

View in Genome Browser
Species Human (GRCh38)
Location 12:120593051-120593073
Sequence GAAGGCAACAGTGTTCTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393865_1103393871 -5 Left 1103393865 12:120593051-120593073 CCCCGGAGAACACTGTTGCCTTC No data
Right 1103393871 12:120593069-120593091 CCTTCTCTCCACCATGTGAGGGG No data
1103393865_1103393869 -6 Left 1103393865 12:120593051-120593073 CCCCGGAGAACACTGTTGCCTTC No data
Right 1103393869 12:120593068-120593090 GCCTTCTCTCCACCATGTGAGGG No data
1103393865_1103393868 -7 Left 1103393865 12:120593051-120593073 CCCCGGAGAACACTGTTGCCTTC No data
Right 1103393868 12:120593067-120593089 TGCCTTCTCTCCACCATGTGAGG No data
1103393865_1103393874 28 Left 1103393865 12:120593051-120593073 CCCCGGAGAACACTGTTGCCTTC No data
Right 1103393874 12:120593102-120593124 GTCCACAGTCTTCAACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393865 Original CRISPR GAAGGCAACAGTGTTCTCCG GGG (reversed) Intergenic
No off target data available for this crispr