ID: 1103393867

View in Genome Browser
Species Human (GRCh38)
Location 12:120593053-120593075
Sequence GAGAAGGCAACAGTGTTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393867_1103393871 -7 Left 1103393867 12:120593053-120593075 CCGGAGAACACTGTTGCCTTCTC No data
Right 1103393871 12:120593069-120593091 CCTTCTCTCCACCATGTGAGGGG No data
1103393867_1103393869 -8 Left 1103393867 12:120593053-120593075 CCGGAGAACACTGTTGCCTTCTC No data
Right 1103393869 12:120593068-120593090 GCCTTCTCTCCACCATGTGAGGG No data
1103393867_1103393876 30 Left 1103393867 12:120593053-120593075 CCGGAGAACACTGTTGCCTTCTC No data
Right 1103393876 12:120593106-120593128 ACAGTCTTCAACCCAGAGGAAGG No data
1103393867_1103393874 26 Left 1103393867 12:120593053-120593075 CCGGAGAACACTGTTGCCTTCTC No data
Right 1103393874 12:120593102-120593124 GTCCACAGTCTTCAACCCAGAGG No data
1103393867_1103393868 -9 Left 1103393867 12:120593053-120593075 CCGGAGAACACTGTTGCCTTCTC No data
Right 1103393868 12:120593067-120593089 TGCCTTCTCTCCACCATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393867 Original CRISPR GAGAAGGCAACAGTGTTCTC CGG (reversed) Intergenic