ID: 1103393869

View in Genome Browser
Species Human (GRCh38)
Location 12:120593068-120593090
Sequence GCCTTCTCTCCACCATGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393861_1103393869 29 Left 1103393861 12:120593016-120593038 CCTCATCAGTGGGATGAATGTGC No data
Right 1103393869 12:120593068-120593090 GCCTTCTCTCCACCATGTGAGGG No data
1103393867_1103393869 -8 Left 1103393867 12:120593053-120593075 CCGGAGAACACTGTTGCCTTCTC No data
Right 1103393869 12:120593068-120593090 GCCTTCTCTCCACCATGTGAGGG No data
1103393866_1103393869 -7 Left 1103393866 12:120593052-120593074 CCCGGAGAACACTGTTGCCTTCT No data
Right 1103393869 12:120593068-120593090 GCCTTCTCTCCACCATGTGAGGG No data
1103393860_1103393869 30 Left 1103393860 12:120593015-120593037 CCCTCATCAGTGGGATGAATGTG No data
Right 1103393869 12:120593068-120593090 GCCTTCTCTCCACCATGTGAGGG No data
1103393865_1103393869 -6 Left 1103393865 12:120593051-120593073 CCCCGGAGAACACTGTTGCCTTC No data
Right 1103393869 12:120593068-120593090 GCCTTCTCTCCACCATGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393869 Original CRISPR GCCTTCTCTCCACCATGTGA GGG Intergenic
No off target data available for this crispr