ID: 1103393874

View in Genome Browser
Species Human (GRCh38)
Location 12:120593102-120593124
Sequence GTCCACAGTCTTCAACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393873_1103393874 -1 Left 1103393873 12:120593080-120593102 CCATGTGAGGGGACAATGAGAAG No data
Right 1103393874 12:120593102-120593124 GTCCACAGTCTTCAACCCAGAGG No data
1103393865_1103393874 28 Left 1103393865 12:120593051-120593073 CCCCGGAGAACACTGTTGCCTTC No data
Right 1103393874 12:120593102-120593124 GTCCACAGTCTTCAACCCAGAGG No data
1103393867_1103393874 26 Left 1103393867 12:120593053-120593075 CCGGAGAACACTGTTGCCTTCTC No data
Right 1103393874 12:120593102-120593124 GTCCACAGTCTTCAACCCAGAGG No data
1103393866_1103393874 27 Left 1103393866 12:120593052-120593074 CCCGGAGAACACTGTTGCCTTCT No data
Right 1103393874 12:120593102-120593124 GTCCACAGTCTTCAACCCAGAGG No data
1103393872_1103393874 2 Left 1103393872 12:120593077-120593099 CCACCATGTGAGGGGACAATGAG No data
Right 1103393874 12:120593102-120593124 GTCCACAGTCTTCAACCCAGAGG No data
1103393870_1103393874 10 Left 1103393870 12:120593069-120593091 CCTTCTCTCCACCATGTGAGGGG No data
Right 1103393874 12:120593102-120593124 GTCCACAGTCTTCAACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393874 Original CRISPR GTCCACAGTCTTCAACCCAG AGG Intergenic
No off target data available for this crispr