ID: 1103393876

View in Genome Browser
Species Human (GRCh38)
Location 12:120593106-120593128
Sequence ACAGTCTTCAACCCAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103393872_1103393876 6 Left 1103393872 12:120593077-120593099 CCACCATGTGAGGGGACAATGAG No data
Right 1103393876 12:120593106-120593128 ACAGTCTTCAACCCAGAGGAAGG No data
1103393873_1103393876 3 Left 1103393873 12:120593080-120593102 CCATGTGAGGGGACAATGAGAAG No data
Right 1103393876 12:120593106-120593128 ACAGTCTTCAACCCAGAGGAAGG No data
1103393870_1103393876 14 Left 1103393870 12:120593069-120593091 CCTTCTCTCCACCATGTGAGGGG No data
Right 1103393876 12:120593106-120593128 ACAGTCTTCAACCCAGAGGAAGG No data
1103393867_1103393876 30 Left 1103393867 12:120593053-120593075 CCGGAGAACACTGTTGCCTTCTC No data
Right 1103393876 12:120593106-120593128 ACAGTCTTCAACCCAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103393876 Original CRISPR ACAGTCTTCAACCCAGAGGA AGG Intergenic
No off target data available for this crispr