ID: 1103396526

View in Genome Browser
Species Human (GRCh38)
Location 12:120611420-120611442
Sequence AGTTACCTGCAGAACATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103396526_1103396528 15 Left 1103396526 12:120611420-120611442 CCTGACATGTTCTGCAGGTAACT No data
Right 1103396528 12:120611458-120611480 GACAGCTCTTGACCTGTTACTGG 0: 5
1: 171
2: 192
3: 142
4: 192
1103396526_1103396529 16 Left 1103396526 12:120611420-120611442 CCTGACATGTTCTGCAGGTAACT No data
Right 1103396529 12:120611459-120611481 ACAGCTCTTGACCTGTTACTGGG 0: 5
1: 184
2: 199
3: 165
4: 198
1103396526_1103396530 22 Left 1103396526 12:120611420-120611442 CCTGACATGTTCTGCAGGTAACT No data
Right 1103396530 12:120611465-120611487 CTTGACCTGTTACTGGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103396526 Original CRISPR AGTTACCTGCAGAACATGTC AGG (reversed) Intergenic
No off target data available for this crispr