ID: 1103400725

View in Genome Browser
Species Human (GRCh38)
Location 12:120641167-120641189
Sequence CGCTGCCGCCGGCCCGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 229}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103400713_1103400725 24 Left 1103400713 12:120641120-120641142 CCGGGAGGCGCTGCCGGCCGCGG 0: 1
1: 0
2: 5
3: 43
4: 490
Right 1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 229
1103400717_1103400725 -2 Left 1103400717 12:120641146-120641168 CCCGACCTTCGCCGTCGTCGCCG 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 229
1103400712_1103400725 25 Left 1103400712 12:120641119-120641141 CCCGGGAGGCGCTGCCGGCCGCG 0: 1
1: 0
2: 1
3: 42
4: 305
Right 1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 229
1103400711_1103400725 26 Left 1103400711 12:120641118-120641140 CCCCGGGAGGCGCTGCCGGCCGC 0: 1
1: 0
2: 2
3: 24
4: 209
Right 1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 229
1103400719_1103400725 -7 Left 1103400719 12:120641151-120641173 CCTTCGCCGTCGTCGCCGCTGCC 0: 1
1: 2
2: 8
3: 150
4: 1601
Right 1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 229
1103400715_1103400725 11 Left 1103400715 12:120641133-120641155 CCGGCCGCGGCGTCCCGACCTTC 0: 1
1: 0
2: 0
3: 3
4: 239
Right 1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 229
1103400718_1103400725 -3 Left 1103400718 12:120641147-120641169 CCGACCTTCGCCGTCGTCGCCGC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 229
1103400716_1103400725 7 Left 1103400716 12:120641137-120641159 CCGCGGCGTCCCGACCTTCGCCG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103400725 Original CRISPR CGCTGCCGCCGGCCCGCGGG CGG Exonic
900240660 1:1615868-1615890 CGCTGGCCCCGGGCCGCGCGAGG - Intronic
900269211 1:1778555-1778577 CGCCGCCTCCCGCCCGCGCGGGG - Intronic
900786947 1:4655290-4655312 CGCGGCCGGCGGGCGGCGGGAGG + Exonic
901629021 1:10639238-10639260 CGCCGCCCCCGGGCCGCGCGAGG - Exonic
902323620 1:15684445-15684467 CGCTGCCGCCGGCCGTACGGGGG - Exonic
902336814 1:15758821-15758843 CGGAGCCGCCGGGGCGCGGGCGG + Intronic
903263477 1:22143243-22143265 CGCTCCGGCCCGCCCCCGGGGGG - Intronic
903324736 1:22563445-22563467 CGCCGCCGCCGCCCCGGGCGGGG - Intergenic
904125599 1:28236289-28236311 CGCTGCTCCAGCCCCGCGGGCGG + Intronic
905432047 1:37931602-37931624 CGGTGCGCCCGGCCCTCGGGTGG - Intronic
905580700 1:39081366-39081388 CGCTGCCGCTAGGGCGCGGGGGG + Intronic
905819552 1:40979324-40979346 CGCTGCCGCCGTCCCTCGCCCGG + Exonic
907038359 1:51236447-51236469 GGCCGCCGCCGCCCCGCGGGGGG + Exonic
907429931 1:54405902-54405924 CGCCGCCGCCGGGCTGCGGGCGG - Intronic
909957763 1:81800977-81800999 CCCTGCGGCCGCCCCGCCGGCGG + Intronic
912383289 1:109259025-109259047 CGCTGCCGCAGCCGCGAGGGCGG + Exonic
915022927 1:152798065-152798087 TGCTGCAGCCAGCCCTCGGGGGG + Exonic
915023572 1:152805174-152805196 TGCTGCAGCCAGCCCTCGGGGGG - Exonic
915025726 1:152827731-152827753 TGCTGCAGCCAGCCCTCGGGAGG + Exonic
918616572 1:186551025-186551047 GGCTGCAGCCGGGCCGGGGGAGG - Intergenic
920528340 1:206684909-206684931 CGCGGCCGCCGGCCCGGGGCTGG + Intergenic
920704919 1:208243899-208243921 CGCTGTCGCCGGCTCTCAGGGGG + Exonic
923141072 1:231162144-231162166 CGCTGCAGCCGGCGGGCGGAGGG - Intronic
923650158 1:235866587-235866609 GACAGCCGCCGGGCCGCGGGCGG - Intronic
1063443014 10:6088927-6088949 CACTGCCCCCTGCCCGCGGGAGG - Intergenic
1063458771 10:6202762-6202784 CGCCGTCGCCGGCCCGCAGGGGG + Intronic
1065023228 10:21517435-21517457 CGCTGCCGCCAGCCCCCGCCCGG - Exonic
1065099570 10:22320748-22320770 CGCGGCCGCCGCCCCCCGGCCGG - Intronic
1070751238 10:78965242-78965264 TACTGCAGCCGGCCAGCGGGAGG + Intergenic
1071544815 10:86521413-86521435 CGCTCCCTACGGCCCGCGGGCGG + Exonic
1072562298 10:96587117-96587139 CACCGCCGCCGGGCCGAGGGAGG + Intronic
1072710909 10:97714886-97714908 CGCAGGCGCTGGGCCGCGGGCGG + Exonic
1074399082 10:113126887-113126909 CGCGGCCGGCGGCGGGCGGGCGG + Intronic
1075048620 10:119165668-119165690 CGCCGCCGCCAGGCCGCGCGTGG + Intergenic
1076156640 10:128210442-128210464 GGCTTCCGCTCGCCCGCGGGTGG + Intergenic
1076844290 10:133061464-133061486 CTCTGCAGCCGGCACCCGGGTGG - Intergenic
1077005887 11:355965-355987 CGCTGCCCTCGGCGCCCGGGAGG + Intergenic
1078152777 11:8773375-8773397 CGCTGCCTCTGACCCTCGGGAGG + Intronic
1078561722 11:12378050-12378072 CGCCCCCGCCGGGCCGTGGGCGG + Intronic
1081812745 11:45922672-45922694 CGCAGCCGCCGGCCAGGGTGCGG - Intronic
1083173133 11:60934596-60934618 GGCGGCCGCCGTCCAGCGGGTGG - Exonic
1084004784 11:66317048-66317070 AGCTGCCGCCAGCCCGGGGCCGG - Intergenic
1084516827 11:69642074-69642096 GGCTGCCGGGAGCCCGCGGGAGG + Intronic
1085043970 11:73342951-73342973 CGCTGCGGCCCGGCCGCCGGCGG - Intronic
1090344991 11:126062651-126062673 CGCCGCCGCGCGCGCGCGGGGGG - Intronic
1091718353 12:2795369-2795391 CGATGCCACCGGCCCCCGGCGGG - Intronic
1096121148 12:49090204-49090226 CGCGGGCGCCGGCCCTCGAGCGG + Exonic
1096584448 12:52610790-52610812 CGCTGACGCCGAGCAGCGGGGGG - Exonic
1097107694 12:56635028-56635050 CGCCGCCGCCGGCCCAGGGCTGG - Intronic
1097155123 12:57006603-57006625 CGCTGCGGCCGGGCGGCGGGGGG - Intergenic
1097191523 12:57221656-57221678 CGCTGCTGTCGGCGCGGGGGCGG - Intronic
1097777928 12:63669151-63669173 CGGAACCGCCGGCCCGCCGGCGG + Intergenic
1097990223 12:65825498-65825520 CGCTCCCCCCGGCCGGCCGGCGG - Intronic
1099989563 12:89708564-89708586 GGCCGCCGCCCGCCCGCGGCCGG - Intronic
1100565627 12:95790912-95790934 CGCTGCCGCTGCCGCCCGGGGGG + Intronic
1101641112 12:106586318-106586340 AGCTGCCGGTGGCCCGCGTGGGG - Intronic
1101970460 12:109309144-109309166 CGCTGCCGGCGCTCCGGGGGTGG + Exonic
1102157483 12:110742739-110742761 CGCCGCCGCCGGCTCGCGCCCGG + Exonic
1103270220 12:119667734-119667756 CGCTGCCGAGGGCCGGCAGGGGG - Exonic
1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG + Exonic
1110887258 13:80655165-80655187 CGCCCCCGCCGGGCTGCGGGAGG - Intergenic
1112216319 13:97434314-97434336 CGCCGCCGCCGGCGCCCAGGGGG + Exonic
1113200993 13:107867328-107867350 CGCTGCCGCAGGGCCGCCCGCGG + Intergenic
1113541774 13:111115151-111115173 CGCCGCCGCCGCCCCGCGCACGG + Intronic
1114483202 14:23047939-23047961 CGCTGCCCCCCCCCCGCGGTGGG + Exonic
1117478191 14:56118353-56118375 CGCCGCCGAAGCCCCGCGGGAGG - Exonic
1118992457 14:70809105-70809127 CGCTGCCGCCCCGCCGGGGGAGG - Exonic
1118992459 14:70809108-70809130 CGCCGCTGCCGCCCCGCCGGGGG - Exonic
1120787988 14:88554621-88554643 CGCGGTCCCCGGCCGGCGGGAGG - Intronic
1121279290 14:92687762-92687784 CTCTGCCGCGAGCCTGCGGGGGG - Intronic
1121617014 14:95319986-95320008 CGCTCGCGCCAGCCCGCGGCGGG - Intergenic
1122231197 14:100306972-100306994 CGCCGCCGCGGGCGCGCAGGCGG - Intergenic
1122947816 14:105021175-105021197 CCCCGCCCCCGGCCCGCGAGTGG - Intergenic
1123065804 14:105618583-105618605 CGCTGCTGCAGCCCCGCGGGGGG - Intergenic
1123069965 14:105637829-105637851 CGCTGCTGCAGCCCCGCGGGGGG - Intergenic
1123074555 14:105661497-105661519 CGCTGCTGCAGCCCCGCGGGGGG - Intergenic
1123089202 14:105734616-105734638 CGCTGCTGCAGCCCCGCGGGGGG - Intergenic
1123094988 14:105762773-105762795 CGCTGCTGCAGCCCCGCGGGGGG - Intergenic
1124578259 15:30928087-30928109 GGCTGCTGCCGGCCTCCGGGAGG + Intronic
1124584332 15:30991532-30991554 CGCTGCCACTGGCCCGCGACGGG - Exonic
1127674810 15:61228932-61228954 CGCCGCCGCAGGCTCGCGCGCGG + Intronic
1128999345 15:72319820-72319842 CGCTGGCCCCGGCCCGCGCCTGG - Exonic
1129153280 15:73702568-73702590 CGCTGCCGTCAGCCTGCAGGTGG + Exonic
1129153594 15:73703972-73703994 CGCTGCCGTCAGCCTGCAGGTGG + Exonic
1130531170 15:84748672-84748694 CGCTCGGCCCGGCCCGCGGGGGG - Intronic
1131153185 15:90059632-90059654 AGCTGCCGCCGGCACGGGGGAGG - Intronic
1132252012 15:100341463-100341485 CGCGGCTGGCGGCCAGCGGGAGG - Intronic
1132491675 16:235048-235070 CGCTGCTGCCGACCCGCTGAGGG - Intronic
1133156588 16:3880512-3880534 CGCCGCCGCCGGGCTCCGGGAGG + Exonic
1133219913 16:4315638-4315660 CGCTGCCCTCGGGCCGGGGGCGG + Intronic
1136154585 16:28374461-28374483 CGGTGCTGCCGGGCCGCCGGAGG - Intergenic
1136208506 16:28740803-28740825 CGGTGCTGCCGGGCCGCCGGAGG + Intergenic
1136556502 16:31010508-31010530 CGCTGCGGGGGGCCTGCGGGCGG + Exonic
1138591183 16:58000532-58000554 GGCTGCGGCCGGACCGGGGGCGG + Intronic
1140078634 16:71723953-71723975 CGGAGCCGGCGGGCCGCGGGGGG - Intronic
1142120098 16:88382965-88382987 CGCGGCCGCCGGCCGGCGTCCGG + Intergenic
1142764326 17:2057101-2057123 CGCCGCCGCCGCCCCGCAGGTGG - Exonic
1142957464 17:3531527-3531549 CGCTGTGGCCGGCCCGGGGGAGG - Intronic
1143202673 17:5123112-5123134 CGCTGCCGCCGCCCCTCTGACGG - Intronic
1144020948 17:11240257-11240279 CTCTGCAGCCGGCCCGCGGCAGG - Intergenic
1144692955 17:17280894-17280916 GGCTCCCGGCGGCCCGAGGGAGG + Intronic
1145240869 17:21240557-21240579 CCCTGCCGCCGGCCCTGAGGAGG + Exonic
1146957214 17:36942693-36942715 CGGTCCCGCCGGCCCCCGGCCGG + Intronic
1147307408 17:39573641-39573663 CGCCGCCGCCGGGCCGCGCCGGG + Intergenic
1152237900 17:79148001-79148023 CGCTGCCGTGGGGCCCCGGGGGG + Intronic
1152688356 17:81706019-81706041 CGCAGCCCCCTGCCCTCGGGTGG + Intronic
1152705936 17:81843681-81843703 CGCTGCCTCCCTCCCGCGGGAGG - Exonic
1155130469 18:22929625-22929647 CGCTGTGGGAGGCCCGCGGGAGG - Intronic
1156316399 18:35972697-35972719 CGCTGCCGCTGGCTCGCCGCGGG - Exonic
1157278981 18:46333803-46333825 CGCCCTCTCCGGCCCGCGGGCGG + Intronic
1160738562 19:675832-675854 CGCTGGAGCCGGCCTGTGGGTGG - Intergenic
1160823147 19:1067522-1067544 AGCTGACGCCGGGCCGCAGGGGG + Intronic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1160877720 19:1304955-1304977 CGCTGCCCCCTGCCCGCGGCGGG - Intergenic
1161026172 19:2038422-2038444 TGCTGCCCCCTCCCCGCGGGTGG - Exonic
1161400650 19:4065349-4065371 CGCTGCGGCCGGGGCGGGGGAGG - Intronic
1162435390 19:10654830-10654852 GGCTGCCGCCTCCCCGCGGCTGG + Intronic
1163121933 19:15223529-15223551 CGCGGCCGCCGGCGGGAGGGAGG - Intergenic
1163334332 19:16661138-16661160 CGCAGTCGCCGGGCCGCGGGCGG + Exonic
1163480897 19:17555726-17555748 CCGCGCCGCCGGCCCGCGCGTGG - Exonic
1163666627 19:18606665-18606687 CGCTGCCGGGGGCGCGCGGCGGG + Exonic
1163714643 19:18866688-18866710 CGCCGCCGCGGGCCAGCAGGGGG - Exonic
1164658542 19:29942329-29942351 CGCCGCCGCCGCCCCGCAGCGGG - Exonic
1165242880 19:34481793-34481815 CGCGTCCCCCGGCCCGCGCGTGG + Exonic
1165431383 19:35775478-35775500 CGCTGCCCCCCGCCCCCGTGGGG + Intronic
1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG + Intronic
1168063463 19:53906930-53906952 GGCTGCCGCCGGCACGGCGGAGG - Exonic
925926878 2:8677113-8677135 CGCTCCCGCCAGCTCGCGGGCGG + Intergenic
927542744 2:23927214-23927236 CGCTGACGCCGCGCCGGGGGCGG - Intergenic
929539843 2:42811047-42811069 CGCTGCCCCTCGCCCCCGGGCGG + Intergenic
930096564 2:47570660-47570682 CGCGGACGCCGGCCACCGGGCGG - Exonic
931309597 2:61065877-61065899 CGCAGCCGCCTGCAAGCGGGCGG + Intronic
931807474 2:65821454-65821476 CACTGCCGCTGTCCTGCGGGTGG + Intergenic
931869039 2:66439902-66439924 CGCCACCCCCGGCTCGCGGGGGG - Exonic
934588588 2:95526931-95526953 CGCCGCCCCCGCCCCGCGGACGG + Intergenic
936126695 2:109794575-109794597 CGCCGCCGCCGCCCCCCGGCCGG - Intronic
937221715 2:120346015-120346037 GGCTGCCGCCGGCTCGCAGGGGG - Intergenic
939791763 2:146587239-146587261 GGCTGCTGCAGGGCCGCGGGTGG - Intergenic
941773235 2:169364520-169364542 AGCGGCCGCCGGCTGGCGGGAGG + Intergenic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942450950 2:176107746-176107768 TCCGGCCGGCGGCCCGCGGGCGG - Exonic
944743665 2:202635346-202635368 CGCCGCCGCCGCTCCGCGTGGGG - Exonic
945225877 2:207530484-207530506 CGCCGCCGCCGGGCCGGGCGCGG + Intronic
945404021 2:209423838-209423860 CGCAGCCGCCGGCCGCCAGGCGG - Intergenic
947418566 2:229921951-229921973 CGCCGCCGCCGCGCCGCTGGGGG - Exonic
947632290 2:231662110-231662132 CGCAGGCGCCGGTGCGCGGGTGG - Intergenic
948047135 2:234952791-234952813 CAGCGCCGGCGGCCCGCGGGCGG + Intronic
948824789 2:240568906-240568928 CGCGGGCCCCGGCCCGGGGGCGG - Exonic
948859550 2:240746240-240746262 CCCTGCCACAGGCCCACGGGAGG + Intronic
1169132587 20:3173701-3173723 CGCTGCGCCCCGCCCGCGCGTGG + Intergenic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1170558064 20:17531335-17531357 CTCTGGCGCGGGCGCGCGGGCGG + Exonic
1173807258 20:45934311-45934333 TTCTGCCGCCGGCCCAGGGGAGG - Intergenic
1173865910 20:46312634-46312656 CGGGGCCGCCAGCCCGCCGGGGG + Intergenic
1174386509 20:50190975-50190997 CGCTCCGGCCGGCCCGCAGGTGG - Exonic
1176110051 20:63407013-63407035 CGCCGCCGCCTGCCCACGAGCGG - Exonic
1178513832 21:33229899-33229921 CGCCGCCGCCGGCGCGGGGGCGG - Intronic
1179654629 21:42837643-42837665 AGGTGCTGCCGGCCAGCGGGAGG - Intergenic
1179882846 21:44300575-44300597 GCCTGGCGCCGGCCCTCGGGAGG - Intronic
1180156826 21:45982075-45982097 CGCTGCAGCCGCCCCGAGCGGGG - Intronic
1180312855 22:11253428-11253450 CGCTGCCGCCGGCCACTGGTTGG - Intergenic
1180559167 22:16601783-16601805 TGCTGCGGGCGGCCCGGGGGAGG + Intergenic
1180837278 22:18936192-18936214 CGCTGCGGGCTGCTCGCGGGAGG + Exonic
1180959646 22:19756841-19756863 CGCTCCCTCCGGGCTGCGGGAGG + Intronic
1181478233 22:23181349-23181371 GGCTGCCCCGGGCCTGCGGGCGG - Exonic
1181745326 22:24952271-24952293 TGCTGGTGCCGGCCCGGGGGCGG - Intergenic
1183093760 22:35540497-35540519 CGCTGGCGCTGGGCGGCGGGAGG + Intergenic
1183201418 22:36387763-36387785 CGCCGCCGCCTGCCCGGGGCGGG + Intronic
1183670741 22:39270900-39270922 CGCTGCTGCCGGGCAGTGGGGGG + Intergenic
1184747288 22:46463739-46463761 CGCTGCCGCAGCCGCGAGGGCGG - Exonic
1184820376 22:46905527-46905549 CCCTGCAGCCGGCCCCGGGGAGG + Intronic
1185100170 22:48836115-48836137 CGCTGCTGCCTGCCAGCGTGGGG + Intronic
1203287371 22_KI270734v1_random:161491-161513 CGCTGCGGGCTGCTCGCGGGAGG + Intergenic
950421237 3:12901073-12901095 CGCTGCCCTCGGCCCACGTGGGG - Intronic
953618221 3:44510723-44510745 CGCTGGCGGCGGGCGGCGGGCGG + Intergenic
953705262 3:45225965-45225987 CGCTGCCGCCCGTCCGCGGCGGG - Exonic
953947880 3:47164392-47164414 CGCTGCCCCCGGCCGCCAGGCGG - Intergenic
954779069 3:53046016-53046038 CGCCTCCGCCGGAGCGCGGGTGG - Exonic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
960896747 3:122514376-122514398 CGCCGCGGCCGGGCGGCGGGCGG - Intronic
961176892 3:124842995-124843017 CGCTGCCGCCGGCCCCGAGAGGG - Intronic
961447785 3:126988968-126988990 CGCTGCCACAGGCCAGCAGGCGG - Exonic
962520744 3:136195850-136195872 GGCCGCCGCCGGCGGGCGGGAGG + Intronic
966915832 3:184583721-184583743 CGCCGCAGCCGGCCCGGGGGAGG + Intronic
968591679 4:1462767-1462789 CGCTGCCGCCAGCCCTTGGCTGG - Intergenic
968701374 4:2059642-2059664 CGCGGCGGCCGGCCCGGGCGCGG - Exonic
968835725 4:2963260-2963282 CGCTCCCGCCGGCGCCCCGGAGG + Exonic
969240328 4:5892996-5893018 CGCTCCCGCCTGCCCGCCCGCGG + Exonic
970394717 4:15654897-15654919 CGGTGGGGCCGGCCCGAGGGCGG + Intronic
973236848 4:47914655-47914677 CGCAGTCGCCGGAACGCGGGCGG - Intronic
985068490 4:186145178-186145200 AGACGCAGCCGGCCCGCGGGCGG - Intronic
985727567 5:1524037-1524059 CGCCCCTGCCGGCCGGCGGGAGG - Intergenic
985895484 5:2748312-2748334 CGCGGCCGGCGGCGCCCGGGAGG - Intronic
987050376 5:14143459-14143481 CGCTCCGGCCGGCGCCCGGGAGG + Intergenic
987099679 5:14581420-14581442 CGCAGCAACCTGCCCGCGGGGGG + Intergenic
988577840 5:32444249-32444271 CGCCGCCGCCGCCCCGCTGTGGG + Exonic
992627544 5:78648860-78648882 CGCCGCCTCCGTCCCGCGAGCGG + Intronic
996862630 5:128083629-128083651 CGCCGCTGCGGGACCGCGGGTGG + Intergenic
997654425 5:135544745-135544767 CGCGCCCGCCGGACCGCGAGCGG - Intergenic
1002498895 5:179634531-179634553 CGCTCCGGCCGGCCGGCAGGGGG - Intronic
1002502781 5:179657993-179658015 CGCTCCGGCCGGCCGGCAGGGGG + Intergenic
1003175578 6:3750889-3750911 CCCGCCCGCCGGCCCTCGGGAGG + Intronic
1004248478 6:14002664-14002686 CCCTCCCGCCCGCCCGCGGTGGG + Intergenic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006472506 6:34236739-34236761 CGCCGCCGCTGCCGCGCGGGTGG - Intergenic
1007680311 6:43629110-43629132 GGCTGCTGCCGGCCCGGAGGGGG - Exonic
1011633987 6:89353140-89353162 CGCAGCCGGCTGCCCGCGCGCGG + Intergenic
1013117652 6:107115046-107115068 CGCTGCCGCCGCCGCGCGGCCGG + Intronic
1013366297 6:109440744-109440766 CTGGGCCGCCGGCGCGCGGGCGG + Exonic
1013366298 6:109440749-109440771 CGCGGCCGCCCGCGCGCCGGCGG - Exonic
1016386814 6:143537241-143537263 CGCGGCCACCTGCCCGCGGCCGG - Intronic
1021231099 7:18086896-18086918 CGCCGCCGCCGCCGCGCGGGGGG - Intergenic
1021998481 7:26202111-26202133 CGCCTCCGCCGGAACGCGGGTGG - Intronic
1022101776 7:27173460-27173482 CGCTGCCGCAAGCCAGCGTGGGG + Exonic
1022375229 7:29806426-29806448 AGCCGCCGCCGCCCCGCGGCAGG - Intergenic
1026850319 7:73719556-73719578 CGCTGGCGGCGGGCGGCGGGCGG + Intronic
1028373262 7:90118764-90118786 CGGAACCGCCGGCCCGCCGGTGG - Intergenic
1029453681 7:100656366-100656388 CGCTGCTAGCGGCCCGTGGGCGG + Exonic
1029640331 7:101816181-101816203 CGCCGCCGCGGGCCCCCCGGCGG - Intronic
1029640526 7:101816720-101816742 TGGTGCCGCCGGCTCGGGGGAGG + Intronic
1029833092 7:103280923-103280945 CGGAACCGCCGGCCCGCCGGTGG + Intergenic
1031629873 7:124033101-124033123 GGCCGCTGCCGGCCCCCGGGGGG + Intergenic
1031629887 7:124033142-124033164 CGCTGCCGCGGGACCGCGGCCGG - Intergenic
1031895930 7:127347833-127347855 CGCCGCCGCCTGGCCGCCGGCGG - Intronic
1032306232 7:130734191-130734213 CGCTGCCGCCGCCGCCCGCGCGG + Intergenic
1033288642 7:140062860-140062882 TGCTCCCGTCGGACCGCGGGTGG + Exonic
1034171612 7:149067078-149067100 CACTGCACCCGGCCCGCGGTTGG - Intergenic
1034342811 7:150368965-150368987 GGCCACCGCGGGCCCGCGGGGGG + Intronic
1034977671 7:155457775-155457797 CGCGGCCGCCGCCCCGCTGCGGG - Intergenic
1036032861 8:4992255-4992277 CGCTGCAGCCCACCCGCGTGGGG + Intronic
1036454202 8:8893416-8893438 CGCAGCCGCGGTCCCGCGGCCGG + Exonic
1036701548 8:11016583-11016605 CGCTGCAGCCAGCCGGAGGGCGG - Intronic
1039620861 8:38996280-38996302 CGCTGGCGCCGCCCAGCCGGAGG - Exonic
1041166909 8:55101122-55101144 CCCCACCCCCGGCCCGCGGGCGG - Intergenic
1041712898 8:60909897-60909919 CGCTGCGGCGGGGCTGCGGGCGG - Intergenic
1041713035 8:60910338-60910360 CGCTGCGGCCGGGCCGGGCGGGG + Intergenic
1042611825 8:70608350-70608372 CGCAGCCGCCGGGCCGCCCGGGG + Exonic
1042696024 8:71556387-71556409 GGCTGCCGCGGGCGCGCGGGCGG - Intronic
1045277633 8:100721849-100721871 AGCTGCTGCGGGGCCGCGGGCGG + Exonic
1046103905 8:109644691-109644713 CGCTGCCGCCGTCCAGGAGGAGG + Exonic
1047998401 8:130357958-130357980 CGCTGCCGCCGCGCAGCTGGAGG - Intronic
1048472056 8:134712718-134712740 CGCGGCCGGCGGCCGGCGGCCGG + Intronic
1049618908 8:143589070-143589092 CGCTGCCGAGGCCCTGCGGGTGG - Exonic
1049697432 8:143990865-143990887 CGCTGCCGGCGTCTCCCGGGTGG - Intronic
1050231168 9:3526743-3526765 CGCTGCGGCGGCACCGCGGGAGG - Intergenic
1052970936 9:34376868-34376890 AGCTGCCGCCGCGCCGCGCGGGG + Intergenic
1059283089 9:113151163-113151185 CGCTGCCGCTGGCCCGGGGCTGG + Intronic
1059335400 9:113565629-113565651 CACGGCCGCCCGCCTGCGGGAGG + Intronic
1060700767 9:125747431-125747453 CGCTCCCGCCCGCGCGCGGCGGG + Exonic
1060952328 9:127612206-127612228 CCCCGCCGCCGGCGCGCGCGGGG - Intergenic
1061506811 9:131036286-131036308 CGGTGCCCCGGGCCCACGGGCGG - Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062230604 9:135479809-135479831 CGCTGCCGCCGCCCCGCGCCCGG - Exonic
1062277228 9:135736736-135736758 CGCTGCTGCCGGCCCGCGGCGGG + Intronic
1062349632 9:136132649-136132671 GGCCGCCGCCGGCCCGCGTCAGG + Intergenic
1062462009 9:136666056-136666078 CCCTGCCGGCGGCGGGCGGGCGG + Intronic
1062465882 9:136681280-136681302 GGCTGCCCCAGGCCAGCGGGAGG + Intronic
1203773832 EBV:62100-62122 CGCTGCCCCTGGCCCGGCGGCGG - Intergenic
1188811461 X:34657450-34657472 CCCCGCCTCTGGCCCGCGGGCGG + Intergenic
1196918258 X:120561157-120561179 CGCTGCAGCCGCCCGGGGGGCGG + Intronic
1197753608 X:129981012-129981034 CGCTGCCGCCGCGCCGCCGCGGG - Intergenic
1200277778 X:154750884-154750906 CCCCGCGGCCGCCCCGCGGGCGG + Intronic