ID: 1103402577

View in Genome Browser
Species Human (GRCh38)
Location 12:120653373-120653395
Sequence CACAGTATGGAGAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103402572_1103402577 2 Left 1103402572 12:120653348-120653370 CCTGTGACTAGTCATGAGCATCT 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG 0: 1
1: 0
2: 2
3: 34
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103402577 Original CRISPR CACAGTATGGAGAAGGAAGC TGG Intronic
901648037 1:10727139-10727161 AACAGCCTGGAGAAGGAAGAGGG + Intronic
901991055 1:13114285-13114307 CAAAGTATGGAGAAAGAACAGGG - Intergenic
902185814 1:14724575-14724597 CACAAAACGGAGAAGGAACCAGG - Intronic
904139506 1:28341266-28341288 CACTGCAAGGAGAAGAAAGCTGG - Intergenic
904489808 1:30851640-30851662 CACAGGATGGGGAAAGAAGAGGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905798236 1:40827433-40827455 CACAGTGTGGGGAAAAAAGCTGG + Intronic
905909843 1:41646240-41646262 CAGCCTATGGAGAAGGAAGGAGG + Intronic
906201451 1:43963117-43963139 CATAGCCTAGAGAAGGAAGCAGG + Intronic
906222155 1:44089301-44089323 GAAAGGAAGGAGAAGGAAGCAGG + Intergenic
907092378 1:51738589-51738611 CACAGTATGGAAAACAGAGCAGG - Intronic
907481137 1:54746320-54746342 CACAGGATGGGGGAGGAAGGTGG - Intergenic
907574292 1:55512117-55512139 CAAAGTTTGGAGAATGAAACAGG + Intergenic
907575402 1:55521667-55521689 CACAGTAGGGAGGAGACAGCAGG - Intergenic
907618317 1:55948161-55948183 CACAGTAAGGAAATGGAGGCAGG - Intergenic
908645308 1:66272018-66272040 CAAAGGGTGGAGGAGGAAGCTGG + Intronic
910838694 1:91540902-91540924 AACAGTCAGGAGAAGGAAGGTGG + Intergenic
910862944 1:91760893-91760915 CACACTATGGAGAATGAAGGAGG + Intronic
911709349 1:101052056-101052078 TATAGTTTAGAGAAGGAAGCAGG - Intergenic
913085615 1:115433885-115433907 CACAGTCTGGAGATGAAACCAGG - Intergenic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
915257039 1:154641349-154641371 CACAGTATGGAGAAAGGGGATGG + Intergenic
915981531 1:160423241-160423263 CACAGTGTTAAGGAGGAAGCAGG - Intronic
918045377 1:180937988-180938010 CACTTTATGGAGGAGGATGCTGG - Intronic
920069362 1:203291115-203291137 TATTTTATGGAGAAGGAAGCTGG - Intergenic
920569887 1:207008610-207008632 CTCTGTATCCAGAAGGAAGCTGG + Intronic
921256855 1:213349389-213349411 CACAGTAAGGAGAAGCAGGATGG + Intergenic
922993537 1:229937829-229937851 CCGGGGATGGAGAAGGAAGCAGG + Intergenic
1063020266 10:2119898-2119920 CACAGTAAGGAGAAGACAACAGG - Intergenic
1064935347 10:20672921-20672943 CACAGGATTAAGGAGGAAGCAGG + Intergenic
1065299501 10:24308513-24308535 CACTGAATGGAGAAGAAGGCAGG + Intronic
1065750323 10:28880000-28880022 CTCAGTGTGGACCAGGAAGCGGG - Intronic
1065971365 10:30808545-30808567 CGCACTGTGCAGAAGGAAGCAGG + Intergenic
1066671434 10:37844592-37844614 CAACGTAGGGAGAAGGCAGCTGG + Intronic
1067285372 10:44903922-44903944 CACAGTGTGAGGCAGGAAGCAGG + Intergenic
1067734709 10:48840586-48840608 CACACCAGTGAGAAGGAAGCGGG + Intronic
1067985567 10:51140030-51140052 TCTAGTTTGGAGAAGGAAGCTGG - Intronic
1069718398 10:70535008-70535030 CACAGGAAGGACAAGGAAGAGGG + Intronic
1069822744 10:71237685-71237707 CACAGGCTGGAGATGGAGGCAGG - Intronic
1070354880 10:75630310-75630332 CAAAGAGTGGAGAGGGAAGCGGG - Intronic
1072227459 10:93383817-93383839 CACAGGATGGAGAAGGATCATGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1074743237 10:116505370-116505392 CACATTGTTAAGAAGGAAGCAGG - Intergenic
1075979949 10:126729492-126729514 CACTCTATGGAGAAGATAGCTGG + Intergenic
1076309550 10:129494895-129494917 CACAGCACAGAGAAGGAAGTTGG - Intronic
1077091281 11:779436-779458 AGCAGTATGGAGGAGGAAGCTGG + Intronic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1080237647 11:30090511-30090533 CATAGTATGGAGAAAGCAGTAGG + Intergenic
1080347308 11:31339326-31339348 CACATTATCAATAAGGAAGCAGG + Intronic
1081843585 11:46221604-46221626 TACATTATGGGGAAAGAAGCAGG + Intergenic
1083059673 11:59856719-59856741 AACAGGCTGGAGAAGGAAGTTGG + Intronic
1083308928 11:61774824-61774846 CACAGGCTGGAGCAGGAAACGGG - Intronic
1083518073 11:63279079-63279101 CACAGTGTGGAGAAGCAGTCAGG - Intronic
1083751737 11:64764750-64764772 CACTTCATGGAGAGGGAAGCGGG + Exonic
1084143584 11:67250684-67250706 CTCAGGATGGAGACGAAAGCTGG + Exonic
1086052172 11:82606048-82606070 CACAGTAAGTAGAAGGACTCAGG - Intergenic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1089301157 11:117499412-117499434 CACTGTATGGATGAGGAAACAGG + Intronic
1089716823 11:120368187-120368209 GACAGTATGGACAATGAGGCGGG - Intronic
1089860950 11:121589628-121589650 CACATTATGTATAAGGAAGGTGG + Intronic
1090178426 11:124672950-124672972 CACAGTATGGAGAAAGCAGAAGG - Intronic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1091030754 11:132185788-132185810 CCCAGGATGGAGTAGGAAGGGGG + Intronic
1092170114 12:6369241-6369263 GGCAGCATGGAGGAGGAAGCCGG - Intronic
1092980953 12:13793716-13793738 CAAAATATGGAGAAAGCAGCTGG - Intronic
1095392590 12:41726768-41726790 CAGAGGATGGAAATGGAAGCTGG + Intergenic
1096233898 12:49912913-49912935 CACAGTCTAGAGGGGGAAGCAGG + Intergenic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096455020 12:51777705-51777727 CACAGTGTGGAGAATGAAGGAGG - Intronic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1101528176 12:105550452-105550474 CTCAGTATGAAGAAGCAACCAGG + Intergenic
1102013396 12:109632644-109632666 CACAGTCTGGAAGGGGAAGCAGG - Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1104391790 12:128397202-128397224 CACAGTATGCTGGAGGAAGGGGG - Intronic
1104700331 12:130898243-130898265 CACAGGAGAAAGAAGGAAGCCGG + Intergenic
1106469099 13:30038934-30038956 CACAGAATGCAAAAGGATGCTGG + Intergenic
1106621294 13:31373520-31373542 CACAGCATGTAGGAAGAAGCTGG + Intergenic
1106621320 13:31373723-31373745 CACAGCATGTAGGAAGAAGCTGG + Intergenic
1110809568 13:79796713-79796735 CACAGTATTCTGAAGGAAGCAGG - Intergenic
1113350260 13:109522537-109522559 CACAGTAGGCAGAAGTGAGCTGG - Intergenic
1113385031 13:109840814-109840836 CACATTTTTGAGAAGGAAGTGGG - Intergenic
1113722463 13:112570020-112570042 CTCAGGATGCAGAAGCAAGCAGG + Intronic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1117487999 14:56217817-56217839 CACTGTATGGAGCAGGCAGAAGG - Intronic
1117547061 14:56802123-56802145 GACAGTGGGGAGATGGAAGCTGG + Exonic
1120454074 14:84709166-84709188 CACAGAATGGGAAAGGAAGAAGG + Intergenic
1120499737 14:85280510-85280532 CAAAATATGGAAAAAGAAGCTGG + Intergenic
1120895941 14:89532482-89532504 AACAGTTTGGAGAGGGAAGAGGG - Intronic
1121436708 14:93925437-93925459 CACAGTAGGCAGCAGGGAGCTGG + Intronic
1121512279 14:94521466-94521488 GACAGTAGGGAGAAGTAGGCAGG + Intergenic
1121594899 14:95154753-95154775 AAAAGTATGGAGATGGATGCTGG + Intronic
1122617344 14:103028693-103028715 CACAGAATATAGAAGGAGGCAGG - Intronic
1122745798 14:103896632-103896654 CACATGATGGGGAAGGAAGGTGG - Intergenic
1122873612 14:104652552-104652574 CTCCATATGGAGAAGGATGCGGG - Intergenic
1124202182 15:27687923-27687945 CACAGCCTGGGGGAGGAAGCAGG - Intergenic
1124208405 15:27742601-27742623 CACTGTCTGCAGAAGCAAGCTGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126767010 15:52019477-52019499 CACACAATGGAGGAGGGAGCCGG - Intronic
1127808902 15:62546134-62546156 CACAGTGTGGAGAGGGAGGTCGG + Intronic
1128523021 15:68387935-68387957 TTCAGCAGGGAGAAGGAAGCGGG - Intronic
1128609869 15:69064967-69064989 CAGTGTTTGGAGAAGGATGCAGG - Intergenic
1129326556 15:74802976-74802998 CACAGAATGGGGAATGAGGCTGG - Exonic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130045408 15:80440466-80440488 CACAGGGTGGAGAAGGAAGCTGG + Intronic
1130579567 15:85123940-85123962 CACAGAATGGAGAAGAAGGGAGG - Intronic
1130837358 15:87663934-87663956 ACCAGTCTGGAGAAGGAAGGAGG - Intergenic
1132520861 16:387907-387929 CAAAGTATAGAGAAGGAAAGGGG + Intergenic
1133198808 16:4189878-4189900 CACAGCATGGAGGAGCAGGCAGG + Exonic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1137601830 16:49761476-49761498 CCCAGTAAGGAGAACGACGCTGG + Intronic
1137863458 16:51869890-51869912 CACAGCATGGAGGAAGAAGGTGG + Intergenic
1138495276 16:57405122-57405144 GACTGGATGGGGAAGGAAGCAGG + Intronic
1139646982 16:68338575-68338597 CACAGCCTGGGGAAGGCAGCGGG + Intronic
1140661550 16:77194559-77194581 GACAGTATGGAGCAGGACCCAGG + Exonic
1142284845 16:89167504-89167526 TCCAGCATGGAGACGGAAGCAGG + Intergenic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1143456686 17:7072396-7072418 CACAGAATGTAGAGGGGAGCAGG - Intergenic
1143831637 17:9656675-9656697 CACAGCTAAGAGAAGGAAGCAGG - Intronic
1144013848 17:11175070-11175092 CAGACTATGGAGAGGCAAGCAGG + Intergenic
1144355232 17:14438984-14439006 CACATAATGGAGAAAGAAACAGG - Intergenic
1145780351 17:27559003-27559025 AACAATATGGAAAAGGAAGGAGG - Intronic
1146431937 17:32805446-32805468 CAAATTATGGTGAAGGAAGCAGG + Intronic
1147976981 17:44253426-44253448 CCAAGTATGGAGAAGGAAGGAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148693828 17:49547566-49547588 CTCAATATAGAGAAGGAAACGGG - Intergenic
1148737426 17:49872777-49872799 CTCAGCTTGGAGGAGGAAGCAGG + Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151177091 17:72297671-72297693 CTCAGTAGGAAGAAAGAAGCTGG - Intergenic
1152730319 17:81966871-81966893 TCCAGTATGGACAAGGAAGCCGG - Intergenic
1153014315 18:569818-569840 CACATTATGAAGGAGGAAGTAGG + Intergenic
1154013342 18:10594324-10594346 CACTGTGTGGACCAGGAAGCAGG + Intergenic
1154121364 18:11655082-11655104 CCCAGTTTGGAGAAGGAGGCCGG + Intergenic
1154152515 18:11917587-11917609 CACTGTGTGGACCAGGAAGCAGG + Intergenic
1155108449 18:22689900-22689922 CACTGCAGGGAGCAGGAAGCAGG + Intergenic
1156952272 18:42916862-42916884 GAAAGGAAGGAGAAGGAAGCAGG + Intronic
1157600033 18:48888121-48888143 CACAGTGCAGAAAAGGAAGCCGG + Intergenic
1157799010 18:50603273-50603295 CACACCAGGGAGATGGAAGCTGG - Intronic
1157918811 18:51695500-51695522 CACAGCATAGATAAGCAAGCTGG - Intergenic
1158050499 18:53212206-53212228 CTCAATATGGAGAAGGATGTTGG - Intronic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1161431378 19:4234260-4234282 CACAGAATAGGGAAGAAAGCTGG - Intronic
1163830645 19:19545672-19545694 GCCAGCATGGAGAAGGCAGCTGG - Exonic
1164003526 19:21129102-21129124 CACTGTGTGAAGCAGGAAGCAGG - Intergenic
1164557018 19:29261102-29261124 CACAGAATGGAAAATGCAGCCGG - Intergenic
1164785112 19:30924359-30924381 CACAGTAAGGAGAAGCCAGGAGG - Intergenic
1164793027 19:31003996-31004018 CACTGTAGGGAGAAGAAAGGTGG + Intergenic
1164894248 19:31856727-31856749 CACAGTATGAAGAACAAAGTTGG + Intergenic
1166852407 19:45766991-45767013 ACCAGGATGGAGGAGGAAGCCGG + Exonic
1167507242 19:49877380-49877402 TACAATATGGAGAAGGAAGTGGG + Exonic
925887867 2:8409002-8409024 CACATCATGGAGATGGAAGGAGG - Intergenic
925887946 2:8409856-8409878 CACATCATGGAGGAGGAAACTGG - Intergenic
926500675 2:13649181-13649203 GAGAGGATGGAGAAGGAAACAGG + Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
927934886 2:27070853-27070875 CAAACTATAGAGAAGGAAGGGGG - Intronic
928047835 2:27955297-27955319 CTCAGTTTGCAGAAGGCAGCTGG + Intronic
929282818 2:40100954-40100976 CAAAGTATGTAAAAGGAGGCTGG - Intronic
930123195 2:47776535-47776557 CACAGGATGGAGAAGATAGCTGG + Intronic
930234345 2:48874591-48874613 CATAGTTTGTAGAAGGAAGGAGG + Intergenic
931058010 2:58494434-58494456 AACAGGATAGAGAAGGAAGCGGG + Intergenic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
931811434 2:65858404-65858426 CACAGTGAGTAGTAGGAAGCAGG + Intergenic
931999278 2:67869163-67869185 CACAGTGTGGAGAGGGAAGGAGG - Intergenic
932518106 2:72374551-72374573 CACAGTGTTGAGAGGGAAGGTGG + Intronic
933646855 2:84820144-84820166 CACATTATGGCCGAGGAAGCAGG - Intergenic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939462299 2:142512876-142512898 TACACTATGGAGAAGGAAGAAGG + Intergenic
940461496 2:153968416-153968438 CACAGCCTGGAGAAAGAATCTGG - Intronic
940893501 2:159057749-159057771 CAAAGCCTGGTGAAGGAAGCAGG + Intronic
941086381 2:161122957-161122979 AACAGGTAGGAGAAGGAAGCTGG - Intergenic
941869894 2:170373067-170373089 TGCAGTATGGAGAATGAAGCAGG + Intronic
942166912 2:173250370-173250392 CACAGCAGGGAGAAGGAAATAGG + Intronic
942442773 2:176053160-176053182 TAAAGTATGAAGAAGGAAACTGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
946020997 2:216640027-216640049 GACAGCATGGAGAAGGCAGGAGG - Intronic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
948077359 2:235175165-235175187 CACAGGATGGAGAAAGACGCAGG + Intergenic
948819557 2:240533425-240533447 CACAGTAAGTAAATGGAAGCTGG + Intronic
948931055 2:241132623-241132645 CACTGTAGGGATAAGGAAACAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1170699278 20:18688825-18688847 CAGAATATTGAGTAGGAAGCAGG + Intronic
1171209429 20:23305337-23305359 CACAGTTTGTGGAAGGAGGCAGG - Intergenic
1171573722 20:26277792-26277814 TACAGTCTGGAAGAGGAAGCCGG + Intergenic
1171806819 20:29688316-29688338 TACAGTCTGGAAGAGGAAGCCGG + Intergenic
1171947231 20:31389487-31389509 CAAAGTAAGGAGTAGGAAGTTGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1173465313 20:43276263-43276285 GACAGCATGGAGGAGGAAGATGG - Intergenic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1174117534 20:48237605-48237627 CACAGTGAGAAGAATGAAGCTGG + Intergenic
1177332728 21:19683170-19683192 CAAAGAAGGGAGAAGAAAGCAGG - Intergenic
1178603984 21:34019132-34019154 CACAGCAGTGAGAAGGGAGCAGG - Intergenic
1178929258 21:36803300-36803322 GAGACCATGGAGAAGGAAGCTGG - Intronic
1179563185 21:42229777-42229799 CACAGTAGGGCAAAGGAAACAGG + Intronic
1181128643 22:20716560-20716582 CACAGCCTGGAGCAGGAAGAAGG - Intronic
1182931879 22:34182113-34182135 CACAGTATGTAGCAAGAGGCAGG - Intergenic
1184942068 22:47776219-47776241 GACATTATGCAGAAGGAAGGAGG - Intergenic
949566975 3:5253957-5253979 CCCATTATGGAGAAGGCAGGTGG + Intergenic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950440701 3:13008575-13008597 CACAGTCAGGAAAATGAAGCAGG - Intronic
950671166 3:14526240-14526262 CACTGTACAGATAAGGAAGCTGG + Intronic
950748154 3:15107388-15107410 TACATTTTGGGGAAGGAAGCAGG + Intergenic
952312196 3:32200204-32200226 TACACTATGGAGAAAGAATCTGG + Intergenic
952522062 3:34171120-34171142 CACATTAGGGACAATGAAGCAGG + Intergenic
953075251 3:39564148-39564170 CCCAGTATGCAGAAGGTAGCAGG - Intergenic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
954131964 3:48565444-48565466 CACAGCATGGAGCTGGGAGCCGG + Exonic
954277357 3:49551330-49551352 CATAGGCTGGAGAAGCAAGCTGG + Intergenic
955401038 3:58591759-58591781 TACAGTATGGTGAAGGAAGCAGG - Intronic
956407886 3:68948056-68948078 CACAGGAAGGAGAAAGAAGTTGG + Intergenic
956587543 3:70880421-70880443 CACAGTCTTTACAAGGAAGCAGG + Intergenic
957524673 3:81364617-81364639 TACAGAATGCAGAAGAAAGCTGG + Intergenic
958943176 3:100336408-100336430 CAAAGTATAGAGAAAGAAGTAGG + Intronic
960858520 3:122127530-122127552 CAGAGTATGGAGCAAGAAGCAGG + Intergenic
960873397 3:122273704-122273726 TACAGCATGGAGAAGGATGATGG + Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961959673 3:130841705-130841727 CTCTGCAGGGAGAAGGAAGCAGG + Intergenic
962374781 3:134850773-134850795 CAGGGTATGGAGAGTGAAGCGGG - Intronic
962662613 3:137619038-137619060 CTAAGGATGGAGAAGGAAGGTGG + Intergenic
962938777 3:140106460-140106482 CACAGGATGGAGCAGGAGGTGGG + Intronic
963538012 3:146552384-146552406 CACTTAATGGAGAAGGAGGCTGG + Intergenic
963569426 3:146973716-146973738 TACACTATGTAGAACGAAGCAGG + Intergenic
963928455 3:150976880-150976902 CACTGTAGGGAGTAGGGAGCTGG - Intergenic
965837502 3:172867578-172867600 CACAGTGTGGAAAAGGACTCCGG - Intergenic
966323583 3:178729333-178729355 CACAGTATTGATTAGGAAGATGG + Intronic
967098529 3:186196902-186196924 CACAGGCTGGAGAGGGAAGATGG + Intronic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968194151 3:196693132-196693154 CACCCTAGGGAGAAGGAACCAGG - Intronic
969651154 4:8469123-8469145 CAAAGGATGAAGAAGGAAACGGG - Intronic
969699910 4:8762277-8762299 CACTGTATGGGGAGTGAAGCTGG - Intergenic
971232456 4:24810838-24810860 CTCAGTGTTGAGAAGGATGCAGG + Intronic
971377553 4:26067412-26067434 CACAGTTGGGAGAAGAAGGCCGG + Intergenic
971545800 4:27884446-27884468 AACACTATGCAGAAGAAAGCTGG - Intergenic
972048425 4:34697561-34697583 TACAGTTTGGAGAAGGAAGATGG + Intergenic
972965861 4:44508763-44508785 CACAGTGAGGAGAAGGAAAAAGG + Intergenic
975760926 4:77618914-77618936 GACTGAATGGAAAAGGAAGCAGG - Intergenic
977564693 4:98568993-98569015 CTCACTGTGGAGAAGGATGCAGG + Intronic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
980678495 4:136123814-136123836 CAAAGTATGTTGAAGGAAACTGG - Intergenic
980889582 4:138800203-138800225 TACAGAATGGAGAACTAAGCTGG + Intergenic
980897481 4:138874112-138874134 AGCAGCATGGAGAAGGCAGCTGG - Intergenic
982324849 4:154119742-154119764 CATTGTATGGAGGAGAAAGCTGG + Intergenic
982327499 4:154143956-154143978 CACACTATGGAGAGAGAAGAGGG - Intergenic
983247217 4:165301720-165301742 CACATTATTTAGAAGGAAGTTGG - Intronic
984504179 4:180595847-180595869 CACTGTATCGAGAAAGATGCAGG + Intergenic
984671383 4:182492057-182492079 CAGAGTATAGAAAAGAAAGCAGG + Intronic
984975766 4:185228872-185228894 CATTGTATGGATCAGGAAGCAGG + Intronic
985931299 5:3059660-3059682 CACAGTCTCGAAAAGGAAGCAGG + Intergenic
988778503 5:34498286-34498308 CACAGTATCGTGGAGGAAACAGG + Intergenic
988994055 5:36697650-36697672 ATCAGGATGGAGAGGGAAGCAGG - Intergenic
989280597 5:39638481-39638503 GAGAGCTTGGAGAAGGAAGCAGG - Intergenic
990868043 5:60401244-60401266 TACTGTATGGAGCATGAAGCCGG - Intronic
990990519 5:61679049-61679071 CACAGAAGGAAGGAGGAAGCAGG + Intronic
991674336 5:69076252-69076274 GAGTGTCTGGAGAAGGAAGCAGG - Intergenic
992836532 5:80647325-80647347 AACAGCATGAAGATGGAAGCAGG + Intronic
993134192 5:83936604-83936626 CACAGTATAGAGGGTGAAGCTGG - Intergenic
995365962 5:111360700-111360722 CACTGTATGGAGAAAGATGCTGG + Intronic
996817828 5:127593375-127593397 TACAGTTTGGAGAAGACAGCTGG + Intergenic
997409593 5:133680968-133680990 CACATGATGGAGAAGGACTCTGG - Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997893958 5:137699334-137699356 AACAGTGAGAAGAAGGAAGCTGG + Intronic
998153760 5:139772284-139772306 CACAATATAAAGAAGGAAACAGG - Intergenic
998166269 5:139846177-139846199 TTCAGTATGGAGAAGGCAGATGG - Intergenic
998252763 5:140563876-140563898 CACAGTCTGGAGGTGGAGGCTGG - Exonic
998660099 5:144227171-144227193 AACACTATGGAGAATGAAGCAGG + Intronic
998721499 5:144956455-144956477 AACAGTATTAAGAAAGAAGCAGG - Intergenic
999373831 5:151072628-151072650 AACAGTATAGAGAAGGCTGCAGG - Intronic
999476512 5:151904482-151904504 CACGCTATGGATGAGGAAGCTGG - Intronic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000393525 5:160749425-160749447 CACAGTATGAGGAGGGCAGCTGG - Intronic
1001683778 5:173577462-173577484 CACAGCAGGGAGGAGGAAGATGG + Intergenic
1001757356 5:174180823-174180845 TACAGGATGGGGAAGGAACCTGG - Intronic
1002025006 5:176390766-176390788 CACAGTATAGAAGAGGAAACAGG + Intronic
1003699249 6:8444038-8444060 CACAGAATAGATAAGCAAGCTGG - Intergenic
1004576962 6:16905850-16905872 CACAGAAGAGGGAAGGAAGCTGG - Intergenic
1004589126 6:17031750-17031772 AGCAGTAAGGAGAAAGAAGCGGG - Intergenic
1004727620 6:18326376-18326398 GGCAGTATGGAGAAGGAATGGGG - Intergenic
1006385112 6:33726504-33726526 GACAGTATGGGGAAGGCAGATGG - Intronic
1006919047 6:37615567-37615589 CCCAGTAGGAAGGAGGAAGCTGG + Intergenic
1007792329 6:44317728-44317750 CACCTTTGGGAGAAGGAAGCTGG - Intronic
1009490979 6:64290365-64290387 AACAGTAGTGAGATGGAAGCTGG + Intronic
1010050229 6:71495408-71495430 CAAAGAATGGGGAAGGAAGGTGG + Intergenic
1013076917 6:106780003-106780025 CACAGTATGGAGAAGAAGACAGG + Intergenic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1015885942 6:137918821-137918843 CACAGAATGGAGATGGGAGTGGG - Intergenic
1016742386 6:147541988-147542010 ACCAGTTTGGAGAAGGAAGGAGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017095333 6:150799855-150799877 CGCAAAATGTAGAAGGAAGCAGG - Intronic
1017604959 6:156123948-156123970 CACAGAATGGGGAGAGAAGCAGG + Intergenic
1017981282 6:159402667-159402689 CACAATGTGGGAAAGGAAGCAGG + Intergenic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018715050 6:166525613-166525635 CACGGTTTGGAGAAACAAGCTGG + Intronic
1018787390 6:167118889-167118911 CACAGAGTAGAGAAGGGAGCCGG - Intergenic
1019226029 6:170510238-170510260 AACAGTGTGGAGAAGGGAGAGGG + Intergenic
1019511544 7:1419992-1420014 CACTGTTTGGAGGAGGAAACCGG - Intergenic
1021446333 7:20737369-20737391 CAAAGGATGGAGAATGGAGCCGG - Intronic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1021909191 7:25367146-25367168 GACAGGAAGTAGAAGGAAGCGGG + Intergenic
1022109368 7:27219182-27219204 CACACTGTGGACAAGGAATCCGG - Intergenic
1023979313 7:45057996-45058018 CACTGGATGGAGCAGGAAACAGG - Intronic
1024620197 7:51150421-51150443 CACTGAATGGAGAAGGTTGCTGG - Intronic
1025284820 7:57652694-57652716 TACAGTCTGGAAGAGGAAGCCGG - Intergenic
1025301600 7:57822961-57822983 TACAGTCTGCAGGAGGAAGCTGG + Intergenic
1026571148 7:71532169-71532191 CAAAGTCAGGAGAAGGAAACAGG - Intronic
1026614641 7:71890464-71890486 CACAGTATGGAGAGAGAAAGAGG - Intronic
1028026839 7:85853630-85853652 CACATTATGAAGAAAGAAGTTGG - Intergenic
1029901058 7:104040150-104040172 GACATTATGGAGAAGGAACAAGG + Intergenic
1030803634 7:113886571-113886593 CAAATTAGGGAGAAGGAATCAGG + Intronic
1032214916 7:129950516-129950538 CACTGTATGGAAAAGGCATCAGG + Intronic
1032264727 7:130362986-130363008 CACAGCATGGTGAGGGAACCTGG + Exonic
1032472724 7:132190099-132190121 AACAGGAGGGAGAAGGAAGAAGG - Intronic
1033088772 7:138366170-138366192 CAAGGAATGGAGAAGGAAGTGGG - Intergenic
1035254669 7:157618705-157618727 AAGAGTATGGAGAAGAAAGTAGG + Exonic
1035744669 8:1953100-1953122 TATATTGTGGAGAAGGAAGCCGG + Intronic
1035828183 8:2667083-2667105 CACATGATTGAGAAGGACGCAGG - Intergenic
1036141933 8:6216814-6216836 GACAGAATGGAGAAAGAAGAGGG + Intergenic
1037295225 8:17392516-17392538 GAAAGTATGGAGAAGAAAGTGGG - Intronic
1038835523 8:31116986-31117008 CAAAGTATGGACAAAGAGGCAGG + Intronic
1039099792 8:33928802-33928824 CTCACTTGGGAGAAGGAAGCTGG - Intergenic
1040573631 8:48631279-48631301 AACAGTAAGAAGCAGGAAGCAGG + Intergenic
1042212494 8:66394796-66394818 CACAGTATGGAGAAGGTTTAAGG - Intergenic
1043706616 8:83358447-83358469 ACCAGTCTGGAGAAGGAAGCAGG + Intergenic
1044623493 8:94213835-94213857 CAGAGTATTGGCAAGGAAGCCGG - Intronic
1044826140 8:96199203-96199225 CACAGTAGGAAGCAGGAAGCTGG - Intergenic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1045981165 8:108189685-108189707 CAGTTTATTGAGAAGGAAGCAGG - Intergenic
1046056846 8:109088280-109088302 CACAGTATCTTCAAGGAAGCAGG + Exonic
1046161337 8:110369575-110369597 GACTGTAGGGAGATGGAAGCTGG - Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1048029243 8:130615535-130615557 CAAAGGGTGGAGAAGGAAGTCGG + Intergenic
1048438317 8:134438958-134438980 AACAGGAAGGAGAAGGAAGTGGG - Intergenic
1049037230 8:140086230-140086252 CAGAGTATGGAGGATGAAGAAGG + Intronic
1049400484 8:142424565-142424587 CACAGGAGGGAGAACAAAGCGGG - Intergenic
1050296137 9:4207239-4207261 CACACTATGCAGAGGGAAGGTGG + Intronic
1050377376 9:4986538-4986560 CTGAGTATGGAGAAGGAAACTGG + Intronic
1052236869 9:26221094-26221116 CACAGTATTCAGAATTAAGCAGG + Intergenic
1053274225 9:36771139-36771161 CACATGGTGGGGAAGGAAGCGGG - Intergenic
1053602500 9:39624712-39624734 CACAGCATGGAAAGGGGAGCAGG + Intergenic
1054251038 9:62717723-62717745 CACAGCATGGAAAGGGGAGCAGG - Intergenic
1054565145 9:66752236-66752258 CACAGCATGGAAAGGGGAGCAGG - Intergenic
1054954159 9:70888948-70888970 ACCAGTATGGAGAAGGAAGTGGG + Intronic
1055425064 9:76186631-76186653 CACTGTATGGAGAAGGAATGAGG - Intronic
1055467252 9:76577864-76577886 CAAGGCATTGAGAAGGAAGCTGG - Intergenic
1057954865 9:99399557-99399579 CACAGGATGGGGAAGGACACTGG - Intergenic
1058433035 9:104935942-104935964 AAGAGGATGGAGGAGGAAGCAGG - Intergenic
1058921978 9:109625477-109625499 TACATTATGGATAAGGGAGCTGG - Intergenic
1058931286 9:109721702-109721724 CAGACAATGGAGAAAGAAGCGGG - Intronic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1060912142 9:127359513-127359535 CACAGTTTTGAGAAGGAAGAAGG - Intronic
1061518962 9:131106172-131106194 CACAGTACTGAGGAGGAAGTGGG - Exonic
1062215374 9:135386229-135386251 CACAGTTTGGAGACTGAAGGTGG + Intergenic
1062556898 9:137117122-137117144 CAAAGTATAGAGAAGGCAGTGGG - Intergenic
1186047705 X:5553809-5553831 CCCAGTATGGAATAGGAAGTAGG + Intergenic
1186579084 X:10797876-10797898 CAAAGTCTGGAGAAGAAAACAGG - Intronic
1186611935 X:11146096-11146118 CACAGTTAGGAGAAGGAGGAAGG + Intronic
1187070559 X:15883358-15883380 CACAGGATGAAGTAGGAAGTGGG - Intergenic
1188745730 X:33840331-33840353 CACAGCATTGAGAAAAAAGCAGG - Intergenic
1190397970 X:50003796-50003818 CACAGCCTAGAGAAGGAAGGGGG + Intronic
1190775073 X:53546130-53546152 CCCAGCATGGAGAAGAAAGGAGG + Intronic
1192725120 X:73741893-73741915 TATAGTATGTAGAATGAAGCAGG - Intergenic
1193998419 X:88395431-88395453 GAAAGCATGGAGAAGGAACCTGG - Intergenic
1194447617 X:94007530-94007552 ACCAGTCTGGAGAAGGAAGGAGG + Intergenic
1194742691 X:97594231-97594253 CACAGTGAGGAGAAAGAATCTGG + Intronic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1197537012 X:127702671-127702693 CACAATATGGAGGAATAAGCAGG - Intergenic
1197991397 X:132321937-132321959 TGCAGTATGGACAAGGAAGTAGG + Intergenic
1198300902 X:135333415-135333437 AGCAGTATAGAGAAGGAAGTAGG + Intronic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1199627594 X:149755129-149755151 CAGAGGATGGGAAAGGAAGCTGG - Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1200757401 Y:7002713-7002735 CACTGTGTGAAGCAGGAAGCAGG + Intronic
1201539843 Y:15094216-15094238 CCCGTTATGGAGTAGGAAGCAGG - Intergenic