ID: 1103407455

View in Genome Browser
Species Human (GRCh38)
Location 12:120686353-120686375
Sequence CTGGCGGGAGTCGCCGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103407455_1103407465 13 Left 1103407455 12:120686353-120686375 CCGCCGGCGGCGACTCCCGCCAG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1103407465 12:120686389-120686411 TCGGTCCCGCCCCTACGCAGCGG 0: 1
1: 0
2: 0
3: 3
4: 45
1103407455_1103407461 -6 Left 1103407455 12:120686353-120686375 CCGCCGGCGGCGACTCCCGCCAG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1103407461 12:120686370-120686392 CGCCAGCGCCTAGGGTGCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 88
1103407455_1103407469 20 Left 1103407455 12:120686353-120686375 CCGCCGGCGGCGACTCCCGCCAG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1103407469 12:120686396-120686418 CGCCCCTACGCAGCGGAGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 57
1103407455_1103407473 27 Left 1103407455 12:120686353-120686375 CCGCCGGCGGCGACTCCCGCCAG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1103407473 12:120686403-120686425 ACGCAGCGGAGGCCGGCCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 199
1103407455_1103407466 16 Left 1103407455 12:120686353-120686375 CCGCCGGCGGCGACTCCCGCCAG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1103407466 12:120686392-120686414 GTCCCGCCCCTACGCAGCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103407455 Original CRISPR CTGGCGGGAGTCGCCGCCGG CGG (reversed) Intergenic
901007648 1:6179687-6179709 CTGGCCCGCGTCGCCGCCCGGGG + Intronic
901319480 1:8330713-8330735 CTGGCGGTAGAAGCCGTCGGGGG - Exonic
902823159 1:18955880-18955902 CGGGTGCGAGCCGCCGCCGGGGG + Exonic
905643808 1:39610344-39610366 CTGGTGGGAGACCCCGCCTGGGG - Intergenic
909622500 1:77683477-77683499 CTGGCGGGCGGCGGCGGCGGCGG + Intergenic
915616910 1:157046000-157046022 TCGGCGGGAGTCGCGGCCGCGGG - Intergenic
915722103 1:157993264-157993286 GTGGAGGGAGGCGCCGTCGGAGG + Intronic
917755476 1:178094047-178094069 CTTGGGGGCGTCGCCGCCAGGGG - Intergenic
919362105 1:196608822-196608844 CTGGCGGGAATCGGGGGCGGTGG + Exonic
919486922 1:198157320-198157342 CTGCCGGGAGGGGCCGCCTGCGG + Intronic
920002288 1:202808088-202808110 CTGGCGTGACTCACCGGCGGCGG + Exonic
1064263971 10:13809608-13809630 CAGGTGGGAGTGGCCGTCGGTGG - Intronic
1071579506 10:86756614-86756636 CTGGCAAGAGTCGGCGGCGGTGG + Intergenic
1072336619 10:94403316-94403338 CAGCGGGGAGTCGGCGCCGGGGG + Exonic
1075119028 10:119651229-119651251 CGGGCCGGAGTCGCCGCGGGCGG - Intergenic
1075129609 10:119726436-119726458 CGGGCGGGAGGAGCCGCCTGCGG + Intronic
1077081935 11:728201-728223 CTGCCGTGAGTGGCCGCCAGGGG + Intergenic
1085050275 11:73376735-73376757 CGGCCCGGAGTCGCGGCCGGAGG - Intronic
1095380460 12:41584493-41584515 CTGGCGGGAGCTGCAGCCTGAGG - Intergenic
1096387453 12:51204259-51204281 CTGGAGGGTGTGGCCGCCGAGGG - Exonic
1096674683 12:53220168-53220190 CTGGAGCGGGGCGCCGCCGGGGG - Intronic
1096700582 12:53380392-53380414 CGGGCGGGAGGCGGCGGCGGCGG + Intronic
1097251075 12:57632614-57632636 CTGGCGGGCGCCCCCGGCGGAGG + Intronic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1121001625 14:90455308-90455330 CTGGCGGGAGCCGTCGCGGCTGG + Intergenic
1124370949 15:29104312-29104334 CTGGCGGGAGGCCCCGCTGTGGG + Intronic
1125954028 15:43777029-43777051 CTGGCGGGAGGTGGGGCCGGGGG - Exonic
1129424719 15:75455043-75455065 CTTGCGGGAGGGGCGGCCGGGGG - Intronic
1130474065 15:84247981-84248003 CTGGCTGGAGTGGTCGCCAGAGG + Intergenic
1130481480 15:84362049-84362071 CTGGCTGGAGTGGTCGCCAGAGG + Intergenic
1131085909 15:89575624-89575646 GTGGCGGGCGGCGCCGCCCGCGG - Exonic
1139513737 16:67441425-67441447 CTAGCTGGAGTCGCCGGCGAGGG - Intronic
1140223242 16:73058661-73058683 CTGGCGGGGGTCGGCGGCGGCGG + Intronic
1141132305 16:81444796-81444818 CGGGCGAGAGTGGCCGCGGGCGG - Intergenic
1141147053 16:81538302-81538324 CAGGCAGGAGCCACCGCCGGGGG - Intronic
1142741534 17:1934547-1934569 TTGGCGGGAGGAGCCGCAGGGGG - Intergenic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1142864185 17:2780326-2780348 CAGGCGGGAGCCGCCGCCTCTGG + Intronic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1147250715 17:39151333-39151355 CTGGCGGGAGCCGGCCCGGGTGG - Intronic
1147648886 17:42050730-42050752 TGGGCGGGAGGCGCCGCAGGTGG - Intronic
1148047644 17:44753787-44753809 CTGGCAGGAATCACTGCCGGTGG + Intergenic
1150675814 17:67245277-67245299 CGGGCGGGAGGCGCGGCCGGAGG - Intronic
1151545634 17:74791270-74791292 CTGGCTGGAGTAGCTGCCTGGGG - Intronic
1152197265 17:78925108-78925130 CGGGCGGGGGCCGCCGCTGGGGG + Exonic
1152197380 17:78925500-78925522 CTGGGGGGAGGCGCGGGCGGAGG - Intergenic
1152467821 17:80475833-80475855 CTGGGGCGAGTGGCCGCCGCGGG + Intronic
1152617965 17:81346375-81346397 CTGGCGGGAGGGGCTGCGGGCGG + Intergenic
1152782119 17:82231211-82231233 CGGGCGGGGGTCGGCGCGGGTGG - Intronic
1155053261 18:22165800-22165822 CCGGCGGGAGCCGGCGCTGGGGG + Intergenic
1157476528 18:48027559-48027581 CTGGCTGGAGTGGCATCCGGTGG + Exonic
1160797908 19:954214-954236 CTGGCAGGAGGGGCGGCCGGGGG + Intronic
1161587689 19:5114405-5114427 CTGGCAGGAGTCGGGGCCAGAGG - Intronic
1162408773 19:10491891-10491913 CTGTCGGAAGTAGCCGCCCGCGG + Exonic
1162720198 19:12657500-12657522 CTGGCGGGAGGTGCCGCTGACGG + Exonic
1162954120 19:14089108-14089130 CTGGCGGGTGCCGCTGCCCGGGG + Exonic
1163113857 19:15177928-15177950 CTTCCCGGGGTCGCCGCCGGGGG - Exonic
1163441650 19:17324985-17325007 CAGGCGGGTGTCGCTGCCTGTGG + Exonic
1165828548 19:38719284-38719306 CTGGGCGGAGTGGCGGCCGGAGG - Intronic
1165851459 19:38852231-38852253 CTGGCGGGCGGCGCCGCGCGCGG - Intronic
1166381339 19:42356808-42356830 CTGGCGGGAGCCGAGGACGGGGG + Exonic
1167985135 19:53308402-53308424 CTGCCGGGAGACGCCTCCAGAGG - Intergenic
1168076322 19:53982535-53982557 CTGGCGGGGGCCGGCGGCGGCGG + Exonic
925386171 2:3463373-3463395 CTGGTGGGAGTGGCTGCCGGCGG + Intronic
926095896 2:10080375-10080397 CGGGCGGGGGTCGCGGCCGGAGG + Exonic
927472317 2:23385557-23385579 CTGCCGGGAGGCGGCGGCGGCGG + Exonic
927667569 2:25042749-25042771 AAGGCGGGAGGCGGCGCCGGCGG + Intronic
930700875 2:54456856-54456878 CTGCAGGGAGGCGCCGGCGGAGG - Intronic
930951290 2:57146615-57146637 CTGGCGGGAGTGGCTGTCGTTGG - Intergenic
940353701 2:152717413-152717435 GTAGCGGCAGTGGCCGCCGGCGG - Exonic
946026782 2:216676692-216676714 CTGGCTGGAGTCGGGGCTGGGGG + Exonic
946325692 2:218983792-218983814 CCGGCGTGAGTCAGCGCCGGAGG + Intronic
946395455 2:219441935-219441957 CGGGCGGGAGCCGGCGCGGGTGG - Intronic
1171868581 20:30508512-30508534 CTGGTGGAAGTCTTCGCCGGAGG + Intergenic
1175847350 20:62065708-62065730 CTCGCTGGAGTCGCAGCTGGCGG - Exonic
1176005768 20:62861634-62861656 ACCGCGGGAGCCGCCGCCGGAGG - Exonic
1179998073 21:44983064-44983086 CAGGCTGGAGGGGCCGCCGGGGG - Intergenic
1181586903 22:23857585-23857607 TGGGGGGGAGTCGCCGCCGCGGG - Intronic
1181638447 22:24184970-24184992 CTGGAGGGCCTCGCCGCCCGAGG + Intronic
1182380516 22:29883521-29883543 CCGGCGGCTGTCGCCGCCAGGGG + Intronic
1185336338 22:50272270-50272292 CTGGAGGGAGCCGCCGGTGGAGG + Intergenic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
954093271 3:48301735-48301757 CTGGCGGGCATCGCCCCCGCCGG - Intergenic
954558767 3:51538720-51538742 CTGGCGAGCGCCGCCGCCGGTGG + Intergenic
954664694 3:52245701-52245723 CCGGCGGGAGGCGGGGCCGGGGG - Intergenic
954912526 3:54121840-54121862 CTGTCGGGCGCCGCGGCCGGAGG + Intergenic
955997064 3:64688183-64688205 CGTGCGGGACTCGCAGCCGGAGG + Intergenic
968233023 3:197015418-197015440 CTGGCTTGAGCCGCTGCCGGCGG + Exonic
972173449 4:36375372-36375394 CTGGCGGGAAGCTCCGCCTGCGG + Intergenic
975616395 4:76251755-76251777 CCGGCCGGAGCCGCCGCCTGCGG - Exonic
984668011 4:182448860-182448882 CTGGCGGGAGGCGGCGGTGGCGG + Intronic
995764597 5:115602058-115602080 AGGGCGGGGGCCGCCGCCGGGGG - Intronic
996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG + Exonic
999781982 5:154857476-154857498 CTGGCGGGAGTGGCTGAGGGCGG + Intronic
1000770109 5:165342303-165342325 CTGGCTGGGGTCGCCGTCGTGGG - Intergenic
1006089486 6:31620209-31620231 CGGGCGGGATTAGCTGCCGGAGG - Intergenic
1006665162 6:35688490-35688512 CTGCCGGGAGAGGCCGGCGGGGG + Intronic
1008932546 6:56955205-56955227 CTGGCGGGCGGCCCCGCGGGAGG - Intronic
1010216201 6:73404095-73404117 CAGGCGTGAGCCGCCGCCGCCGG + Intronic
1012399930 6:98834671-98834693 CGGGCGGGAGGCGGCGGCGGCGG + Exonic
1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG + Intronic
1018156572 6:160991421-160991443 CCGGCCGGAGTCGCCGCCCAGGG - Intergenic
1019711823 7:2521328-2521350 CTGGCGGGAGGGGGCGGCGGGGG + Intronic
1019749400 7:2719243-2719265 CAGGCGGGAGAGGCGGCCGGAGG - Intronic
1020022641 7:4878264-4878286 CGGGCAGGAGTCACCGCCTGTGG - Intronic
1020099864 7:5388760-5388782 CCGGCGGGGGTGGCCGCGGGGGG + Exonic
1020213698 7:6173015-6173037 CTGGTGGGAGTCGCCTCAGCCGG - Intronic
1020224948 7:6272560-6272582 CGGGCTGGGGACGCCGCCGGAGG + Exonic
1027540080 7:79454487-79454509 CTGGCGGGACGCGCGGGCGGGGG - Intergenic
1035663185 8:1362467-1362489 CTGACGGGTGTCCCCGCCGGAGG - Intergenic
1037450881 8:19014328-19014350 CTGGGGGGACTCGCCTCAGGGGG - Intronic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1040038706 8:42896284-42896306 CTGTCCGGAGTCGCCGGCGACGG - Exonic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1045098935 8:98825869-98825891 CTGGCGGCCGGCGCGGCCGGGGG - Intronic
1049476460 8:142799267-142799289 CTGGCTGAAGTCACTGCCGGTGG + Intergenic
1052971003 9:34377117-34377139 CCGGCGGGAGTCGGAGCCGCGGG - Intergenic
1053149321 9:35732644-35732666 CGGCCGGGATTCCCCGCCGGCGG - Exonic
1061613254 9:131762591-131762613 CTGGCGGGCCTGGCTGCCGGCGG + Intergenic
1061803474 9:133125828-133125850 CTGGCAGGAGTCACTGCCCGGGG - Intronic
1061975933 9:134068072-134068094 CTGGCGGGAGTCGTAGTCCGCGG + Intronic
1192562985 X:72139680-72139702 CTGGCTGGAGTAGCCACTGGAGG - Exonic
1202376854 Y:24246071-24246093 CTGGCTGGAGTGGTCGCCAGAGG - Intergenic
1202493926 Y:25424050-25424072 CTGGCTGGAGTGGTCGCCAGAGG + Intergenic