ID: 1103409845

View in Genome Browser
Species Human (GRCh38)
Location 12:120703141-120703163
Sequence AAGGGATAACTGAGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103409845_1103409857 27 Left 1103409845 12:120703141-120703163 CCTACCTCCCTCAGTTATCCCTT 0: 1
1: 0
2: 0
3: 29
4: 328
Right 1103409857 12:120703191-120703213 AAGAGTGAGGCCATTGTTGATGG 0: 1
1: 0
2: 2
3: 12
4: 155
1103409845_1103409853 14 Left 1103409845 12:120703141-120703163 CCTACCTCCCTCAGTTATCCCTT 0: 1
1: 0
2: 0
3: 29
4: 328
Right 1103409853 12:120703178-120703200 AGTGTGCAGCCCCAAGAGTGAGG 0: 1
1: 0
2: 1
3: 14
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103409845 Original CRISPR AAGGGATAACTGAGGGAGGT AGG (reversed) Intergenic
900603136 1:3511737-3511759 TAGGGGTAACTAAGGTAGGTGGG - Intronic
900853639 1:5163327-5163349 AAGGGATGACTGAGGGAGAATGG - Intergenic
900993477 1:6108345-6108367 AAGGGATAATGGAGGGATGGAGG + Intronic
900993527 1:6108567-6108589 AAGGGATAATGGAGGGATGGAGG + Intronic
901352711 1:8611905-8611927 GAGGGAGTAGTGAGGGAGGTAGG - Intronic
901360916 1:8699625-8699647 AAGGAATAATGGAGGGAAGTAGG - Intronic
901937595 1:12637186-12637208 AAAGTACAACTGAGGGGGGTGGG - Intergenic
902799098 1:18818419-18818441 GAGGGGGAGCTGAGGGAGGTGGG + Intergenic
903068810 1:20716548-20716570 CAGGGAGAACTGGGGGAGCTGGG + Intronic
904175969 1:28629151-28629173 AACTGATAACAGAGGGAGGTGGG + Intronic
905775489 1:40665195-40665217 AAGGGATGAGAGAGGGACGTGGG - Intronic
906268484 1:44454790-44454812 AAGGGATTTTTGAGGGTGGTAGG - Intronic
908428289 1:64030541-64030563 AAGGAATGAGTGACGGAGGTAGG - Intronic
909187260 1:72503451-72503473 AAGTGATAATTGAGGAATGTAGG - Intergenic
909816765 1:80004209-80004231 AAGGGATAACAGAGAGTGTTTGG + Intergenic
910228285 1:84959669-84959691 AAGAAATCACTTAGGGAGGTGGG - Intronic
910384445 1:86665682-86665704 AAAGGAGCACTGAGGAAGGTAGG - Intergenic
911285883 1:95991697-95991719 AAGAAATAAATGAGGAAGGTAGG + Intergenic
911922377 1:103781871-103781893 ACTGGATAACTGAGGGATGCTGG + Intergenic
913105438 1:115609907-115609929 AAGGGACATCTGGGGGTGGTGGG - Intergenic
914322099 1:146575084-146575106 AAGTGTTAATTCAGGGAGGTTGG - Intergenic
914852709 1:151327020-151327042 CAGGGATGAGTGAGGGAGGGGGG + Intronic
915298962 1:154941323-154941345 AAGGGAGACCTGGGAGAGGTGGG + Intergenic
915335118 1:155136405-155136427 AAAGGCTACCAGAGGGAGGTGGG + Intronic
915626465 1:157117154-157117176 AAGGGGAAACTGAGGTATGTAGG - Intergenic
916078149 1:161215150-161215172 AAGGGCCAACTAAGGGAGTTGGG - Intergenic
916081654 1:161237177-161237199 AAGGAATAAGAGAGGGAGGGAGG - Intronic
916102392 1:161403980-161404002 AACTGATAACTGGGGGAGGGGGG + Intergenic
916522509 1:165577560-165577582 AAGGGATTTCTGAGGGATGATGG + Intergenic
916939369 1:169663504-169663526 CATGGAGAACTGAGGAAGGTCGG - Intronic
917683736 1:177394806-177394828 AAAGGTTACCAGAGGGAGGTAGG + Intergenic
918160733 1:181896679-181896701 AAGTGACATCTGAGGCAGGTAGG - Intergenic
922041369 1:221901805-221901827 CATGGATTCCTGAGGGAGGTCGG - Intergenic
923112978 1:230907770-230907792 AAGGCAAAACTGGGGGTGGTTGG + Intronic
923114535 1:230922667-230922689 AATGGAAAACAGAGAGAGGTGGG - Intronic
923208739 1:231783895-231783917 AAGGGATAATGGAGGGAGAAAGG - Intronic
923411825 1:233718151-233718173 GAGGGATATCTGAGGCAAGTGGG + Intergenic
923742110 1:236664413-236664435 AGGGGCTCACTGAGGGAGGAGGG - Intergenic
924391614 1:243566502-243566524 AAGGGATGACTGAGAGAGATGGG + Intronic
1063691366 10:8290588-8290610 AAGGCAAAAGTGAGAGAGGTTGG + Intergenic
1063717113 10:8539121-8539143 AAAGGGTAACTGTGGAAGGTGGG - Intergenic
1063905665 10:10777805-10777827 AAGTGATAAGGGAGAGAGGTAGG - Intergenic
1063969845 10:11373884-11373906 AAAGGATGATTGAAGGAGGTTGG - Intergenic
1067278994 10:44857297-44857319 ATGGGGTAGGTGAGGGAGGTGGG - Intergenic
1067355407 10:45520058-45520080 ATGTGATAACTGATGGAGGTGGG - Intronic
1068025267 10:51634928-51634950 AGGGCATACTTGAGGGAGGTGGG + Intronic
1069724366 10:70567668-70567690 AAGGGTGCACTGAGGGTGGTGGG + Exonic
1074336391 10:112580674-112580696 AATGGCTAACTGTGGGAGGCAGG + Intronic
1076667585 10:132101930-132101952 CAGGGAGGACTGTGGGAGGTGGG + Intergenic
1076735536 10:132457403-132457425 AAGGGGAAACTGAGGCAGGGTGG + Intergenic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1079907399 11:26266239-26266261 AAGTGATGAATGAGAGAGGTGGG - Intergenic
1080514315 11:33006014-33006036 GAGGGGTAGCTGTGGGAGGTGGG + Intergenic
1080660568 11:34292862-34292884 AAGGAGTCACTGAGGAAGGTAGG + Intronic
1081828649 11:46085399-46085421 CAGTGATGACTGAGGGAGATAGG - Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1083191530 11:61055835-61055857 TGGGGATAAATGAGGGAGGGAGG + Intergenic
1083223753 11:61270718-61270740 CATGGATAACTGAGGGAGTGGGG - Intronic
1083515778 11:63257458-63257480 AAGGGAGAAGGGAGGGAGGGAGG - Intronic
1084408415 11:68992111-68992133 AAGGGATAAGGGTTGGAGGTGGG + Intergenic
1084884075 11:72192025-72192047 CTGGGAAAACTGAGGGAGATGGG + Intronic
1085329719 11:75637877-75637899 AAGGAAGGACTGAGGGAGGGAGG + Intronic
1085331848 11:75658695-75658717 AAGGGACAGAAGAGGGAGGTAGG - Intronic
1085701998 11:78754018-78754040 ATGGAAGAACTGAGGGAGGGAGG - Intronic
1087325080 11:96711673-96711695 AAGAGACAACTGAGGGAAATAGG - Intergenic
1087439119 11:98160535-98160557 GAGAGATAACTGAGTGAGATGGG - Intergenic
1087692232 11:101334715-101334737 AAGATACAACAGAGGGAGGTAGG - Intergenic
1089725272 11:120472380-120472402 TAGGGAAAATTGAGGGGGGTGGG + Intronic
1090043166 11:123308520-123308542 TAGGGATAACTGAGGAAGCAAGG + Intergenic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091317125 11:134622421-134622443 AAGGGATAACTGGGATAAGTTGG - Intergenic
1091700186 12:2653978-2654000 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1091942781 12:4504079-4504101 ATGGGATAACTGAAGGTGGGAGG + Intronic
1092216933 12:6689758-6689780 AAGGGACATCTGGGGAAGGTGGG + Intergenic
1092450038 12:8593343-8593365 AAGGGAGAAAGGAGGGAGGGAGG + Intergenic
1093420569 12:18969550-18969572 AAGGGATAACTCTGGAAGATAGG + Intergenic
1093767299 12:22979639-22979661 AATGCATAACTGAGGGTGGTGGG - Intergenic
1094229551 12:28087087-28087109 AAGGAATAACTGCGGGGGGGCGG + Intergenic
1095095900 12:38149074-38149096 AAGGGAGTAGTGAGGGAGGGAGG - Intergenic
1096372571 12:51081423-51081445 AATGAATAATTGAGAGAGGTAGG - Intronic
1096436983 12:51600648-51600670 AAGGCAGAACTCAGGGAGCTTGG + Intronic
1096478868 12:51924775-51924797 AAGGCAGGACTGAGGGAGGATGG - Intergenic
1097075182 12:56387790-56387812 TAGGGAAAACTGAGGGGTGTGGG - Intergenic
1097281906 12:57850188-57850210 GAGGGGTAAATGAGGGAGGAGGG + Intergenic
1099045440 12:77711678-77711700 AGGGGATCTCTGAGGGAGGTGGG + Intergenic
1099857066 12:88181059-88181081 AAGGGATACCTGTGGAATGTTGG + Intronic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100889016 12:99103065-99103087 AAAGGAAAACTGCTGGAGGTAGG + Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1103409845 12:120703141-120703163 AAGGGATAACTGAGGGAGGTAGG - Intergenic
1104882915 12:132084616-132084638 GAGTGTTCACTGAGGGAGGTGGG - Intronic
1106973806 13:35180818-35180840 AAGGGAAAAGTGTGGGAAGTGGG - Intronic
1107904519 13:45049965-45049987 AAGGGGTAACTGAGGGAGCAAGG - Intergenic
1109873995 13:68374120-68374142 AAAGGAAAAGAGAGGGAGGTAGG + Intergenic
1111495232 13:89039415-89039437 AAAGGATAACTGAGAAAGGAAGG + Intergenic
1111704185 13:91727354-91727376 AATGGATGTCTGAGAGAGGTGGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115653479 14:35420700-35420722 AAGGGAGAAGGGAGGGAGGGGGG + Intergenic
1119004923 14:70915959-70915981 AAGGGATAAATCATGGAGGAAGG + Intronic
1119206689 14:72799665-72799687 AACGGATCACTAAGGGATGTGGG - Intronic
1119605299 14:76010885-76010907 AAAGGAGAAGTGAGGGAGTTAGG - Intronic
1119788333 14:77328783-77328805 AAGGGAGAAGTGAGGGAGACAGG + Intronic
1121854253 14:97252048-97252070 AAGGGACCACAGAGAGAGGTGGG + Intergenic
1122191602 14:100048956-100048978 AAGGGAGAGCTGAGGGAGCTTGG + Intronic
1123204595 14:106700337-106700359 ATGGGATACCTGAGGAATGTCGG - Intergenic
1123634747 15:22293028-22293050 GAGGGAGTAGTGAGGGAGGTAGG + Intergenic
1124260696 15:28187790-28187812 AAGGCAGAACAGAGGAAGGTTGG - Intronic
1124553702 15:30706981-30707003 AAGGGATAACTGTGAAAGGCGGG + Intronic
1124677546 15:31698693-31698715 AAGGGATAACTGTGAAAGGCGGG - Intronic
1124698018 15:31882740-31882762 AAGAGGAAACTGAGTGAGGTTGG + Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127904416 15:63365728-63365750 AAGGGAGACCAGAGGGATGTAGG - Intronic
1127989991 15:64106967-64106989 TAGGGAGAAATGAGTGAGGTGGG - Intronic
1130820494 15:87490153-87490175 AGGGTATAACTGAGGAAAGTGGG + Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132953593 16:2578780-2578802 CAGGAAAAACTGTGGGAGGTGGG + Intronic
1132960758 16:2621387-2621409 CAGGAAAAACTGTGGGAGGTGGG - Intergenic
1133224226 16:4332971-4332993 AAGGGAACACTGAGGCAGGAAGG + Intronic
1133982853 16:10646531-10646553 AAGGAATGACTGAATGAGGTTGG + Intronic
1135547812 16:23377575-23377597 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1136450245 16:30350670-30350692 AAGGGAGAACTTAGTGAGATCGG + Intergenic
1136613552 16:31381725-31381747 AAGAGATGACTGAGGGAGAGGGG - Intronic
1137670381 16:50274978-50275000 ATGGGGAAACTGAGGCAGGTGGG + Intronic
1138029706 16:53550668-53550690 AAGAAAGAAGTGAGGGAGGTTGG - Intergenic
1138980208 16:62258840-62258862 AGGGGATAACTGAGGAATGAAGG + Intergenic
1139532975 16:67552502-67552524 AGGGGACAACAGAGGGAGGGAGG + Intergenic
1139651685 16:68365458-68365480 AGGGTGTAACTGAGGGAGGGAGG - Intronic
1139818642 16:69700176-69700198 AAGGGAGAAAGGAGGGAGGGAGG - Intronic
1140011528 16:71136081-71136103 AAGTGTTAATTCAGGGAGGTTGG + Intronic
1141796477 16:86278709-86278731 AAGGGTATAGTGAGGGAGGTTGG - Intergenic
1143515894 17:7419032-7419054 AACGGAGAACTGAGGCAGGGTGG - Exonic
1143524338 17:7463454-7463476 AAGTGATAACCGAGGCAGCTTGG + Exonic
1145079071 17:19879673-19879695 AAGGGGGAAAAGAGGGAGGTGGG - Intergenic
1146306813 17:31736282-31736304 AAGAGAGAAGTGAGGGAGGGAGG + Intergenic
1146525809 17:33566076-33566098 AAGGGAGAGCTGAGTGAGGAGGG - Intronic
1146736710 17:35244337-35244359 AAGGGATGCTTGAGGGAGGATGG + Intronic
1147156205 17:38545562-38545584 ATGGGAAAACTGAGGCAGGGAGG + Intronic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1148262816 17:46198186-46198208 AAAGAATAAGTGAGGGAGGCAGG - Intronic
1148330385 17:46810581-46810603 ATGAGAAAACTGAGGGAGGGAGG + Intronic
1149462076 17:56836988-56837010 AAGGAAAAACTGGGGGAGGAGGG - Intronic
1150275465 17:63895269-63895291 AATGGATAAATGAGAGAGGGAGG - Intronic
1150277598 17:63909958-63909980 AATGGATAAATGAGAGAGGGAGG - Intronic
1150879735 17:69010494-69010516 AAGAGACAAATGAGGGAGGGAGG + Intronic
1151345870 17:73500812-73500834 GATGGAGAACTGAGGGAGGATGG - Intronic
1152671965 17:81613835-81613857 GAGGAATGGCTGAGGGAGGTGGG - Intronic
1153098533 18:1437392-1437414 GAGGGAAATCTGAGGGTGGTTGG - Intergenic
1155010135 18:21769166-21769188 AAAGGATAACAGAGGTAGGTGGG - Intronic
1157028566 18:43876875-43876897 AAGGAGTAACTGTTGGAGGTGGG - Intergenic
1157298705 18:46464369-46464391 AACGGATAATAGAGGGAGGTAGG - Intergenic
1158155726 18:54423378-54423400 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1163033397 19:14558715-14558737 AAGGGATACCTGTGGGAGGGGGG - Intronic
1163350008 19:16770623-16770645 ATGGGAAAACTGAGGGCTGTGGG - Intronic
1163558896 19:18007699-18007721 AAGGGAGAAGTGGAGGAGGTGGG - Intronic
1164771967 19:30816339-30816361 AAGGAATAAGGGAGGGAGGAAGG - Intergenic
1165280073 19:34788920-34788942 AAATGATAACTGTGTGAGGTAGG - Intergenic
1166171306 19:41029264-41029286 AGGGAATAAGTGAGGGAGCTGGG + Intergenic
1166441549 19:42819691-42819713 AAGGAATACCTGAGTGAGGCTGG - Intronic
1166460982 19:42987983-42988005 AAGGAATACCTGAGTGAGGCTGG - Intronic
1166478271 19:43147963-43147985 AAGGAATACCTGAGTGAGGCTGG - Intronic
925223706 2:2163298-2163320 TAAGTATAACTGAGGCAGGTAGG - Intronic
926442789 2:12907642-12907664 AAGAGATCATTGAGGGAGGATGG - Intergenic
926974023 2:18495372-18495394 AAGGAATAAGGGAGGGAGGGAGG - Intergenic
927330357 2:21855415-21855437 AAGGAATAAATGCGGGGGGTGGG - Intergenic
927848380 2:26483744-26483766 AAGGGACAGCTGAGGGAGCAAGG + Intronic
928133583 2:28671345-28671367 AAGGACTAACTGAGGCATGTAGG + Intergenic
928704486 2:33933307-33933329 AAAGCAGAACTGAGGGAGGCAGG - Intergenic
929328458 2:40648157-40648179 AATGGATAAGAGAGGGAGATAGG + Intergenic
929777731 2:44939128-44939150 CAGGGAGAACTGAGGCAAGTGGG - Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930833461 2:55770236-55770258 AAGGGAGAAGGGAGGGAGGGAGG - Intergenic
930835363 2:55787338-55787360 AATGTTTACCTGAGGGAGGTAGG - Intergenic
931464373 2:62473794-62473816 AAGGGATCACAGAGGGATGCTGG + Intergenic
931616644 2:64165900-64165922 TAGTGAACACTGAGGGAGGTAGG - Intergenic
933576276 2:84072119-84072141 AAGGAAAAAAAGAGGGAGGTAGG + Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
935063286 2:99626527-99626549 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
936233567 2:110724931-110724953 AAGGAAGAACGGAGGGAGGAAGG + Intergenic
937005511 2:118509099-118509121 GAGGGATAGCTGAAGGATGTGGG + Intergenic
938174033 2:129107898-129107920 AGGGGCTAAGTAAGGGAGGTGGG - Intergenic
939521194 2:143232651-143232673 AAGGGACAACTGATAGGGGTTGG - Intronic
940019878 2:149145634-149145656 AAGGGAGAAGGGAGGGAGGCTGG - Intronic
940254948 2:151718681-151718703 GAGGGATGACTGAGAGAGCTGGG - Intronic
941122367 2:161545654-161545676 TAGTGGTAACTGAGGGAGGCAGG + Intronic
942572376 2:177327305-177327327 AAGGAATAACTGAGAGAGTGAGG + Intronic
942923494 2:181405506-181405528 AAGGGGTAACTGAGTGATGATGG - Intergenic
943374331 2:187055860-187055882 CATGGAAAACTGAGGGAAGTGGG - Intergenic
944097497 2:195985422-195985444 AAGGGATAACTGAAGGAGCCAGG + Intronic
944617400 2:201475854-201475876 AAGTGAAAATTGAGGGAGGAAGG + Intronic
946439635 2:219684537-219684559 AAGTATTAAATGAGGGAGGTAGG - Intergenic
947194648 2:227548992-227549014 AAAGGTTAACTGAGGGAGAAGGG - Intronic
948093711 2:235316711-235316733 ATGCAATAACTGAGGAAGGTGGG - Intergenic
948121303 2:235532756-235532778 AAGGGTAAGCTGAGGCAGGTAGG - Intronic
948858331 2:240740917-240740939 AAGGGACTTTTGAGGGAGGTGGG - Intronic
948974713 2:241457253-241457275 GAGGGAGAAATGAGGAAGGTGGG - Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1172601836 20:36189403-36189425 AAGGGATAGGTGGGAGAGGTAGG - Intronic
1172917099 20:38451240-38451262 ACGGGATAACTTAGGGATGGAGG + Intergenic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173744645 20:45426936-45426958 ATGGGAGAACTGAGTGGGGTAGG - Intergenic
1174292374 20:49518123-49518145 AAGGGAGACCTGAGGGATGGGGG + Intronic
1174905118 20:54541900-54541922 AGTGGATATGTGAGGGAGGTGGG - Intronic
1175229665 20:57465733-57465755 AAGGGATTACTGAGGCAGGCGGG - Intergenic
1177894854 21:26845849-26845871 AAGAGGGAACTGAGGGAGGAGGG - Intergenic
1178024744 21:28453444-28453466 AAGGTAGAACTGAAAGAGGTTGG + Intergenic
1178350561 21:31870527-31870549 AAGAGACAACAGAGGGAGATGGG + Intergenic
1180700188 22:17777310-17777332 AAGGGGTAACTGAGGAAGAGGGG - Intergenic
1184274845 22:43404355-43404377 AAGGGATAATTGAGGTGGGGAGG - Intergenic
1184692327 22:46122958-46122980 AAGCGAGAACAGAGGGAGGTGGG - Intergenic
951678738 3:25272504-25272526 AGGGGATACCTGAGTGATGTAGG - Intronic
951707769 3:25560694-25560716 AAGGAAAAAATGAGGGAGGGAGG - Intronic
951788166 3:26447701-26447723 AAGATATAAGTGAGGGAGGGAGG - Intergenic
951886051 3:27525628-27525650 AATGAATAACCCAGGGAGGTAGG - Intergenic
951914426 3:27784931-27784953 AAGGGAAAACTTAGGGAAGGTGG - Intergenic
953779431 3:45853643-45853665 AAGGGATAATTGATGGAGCTTGG - Intronic
955017698 3:55088022-55088044 AAGAGATGACTTAGGGAGGGAGG - Intergenic
955609946 3:60746324-60746346 GAGAGATAATTGAAGGAGGTGGG + Intronic
955697240 3:61649120-61649142 AAGGGAAAAGGGAGGGAGGGAGG - Intronic
957511900 3:81200353-81200375 AAGGGATAATTGAGGATGGCTGG - Intergenic
959382059 3:105653289-105653311 AAGGGAGAACTGGGTGAGATTGG + Intergenic
959827216 3:110812693-110812715 TAGGGATAAATGATGCAGGTGGG - Intergenic
959827220 3:110812712-110812734 TAGGGATAAATGATGCAGGTAGG - Intergenic
960201501 3:114842387-114842409 AAGGTAGAGATGAGGGAGGTTGG - Intronic
960369872 3:116821714-116821736 AAGGGATAAAGCAGGGAGGGAGG + Intronic
961455692 3:127022868-127022890 AGGGGAAAACGGAGAGAGGTGGG + Intronic
961543818 3:127618333-127618355 GAGGCAGAAGTGAGGGAGGTGGG - Intronic
962595645 3:136940871-136940893 AAAGGATAACTGAGAGAGTGGGG - Intronic
962626845 3:137234197-137234219 AAGGCTTAACTGGGGGAGGATGG - Intergenic
962678110 3:137771002-137771024 CGGTGATAACCGAGGGAGGTGGG + Intergenic
963574723 3:147045713-147045735 AAGAGGTAAGTGAAGGAGGTTGG - Intergenic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964645443 3:158953919-158953941 AAGGGAGAAGGGAGGGAGGGAGG + Intergenic
965424644 3:168506881-168506903 AAGGAATAAGGGAGGGAGGGAGG - Intergenic
965619357 3:170627021-170627043 AAGAGGGAACTGAGGGAGGTGGG - Intronic
968825344 4:2892084-2892106 AATGAATAAATGAGGGAGGCTGG + Intronic
968979020 4:3836806-3836828 AAAGCAAAACTGTGGGAGGTGGG - Intergenic
969495830 4:7525693-7525715 AAGGGACAAGTGACTGAGGTGGG - Intronic
970538316 4:17052669-17052691 AAGAGTTAACTAAGGAAGGTTGG + Intergenic
970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG + Intergenic
970872313 4:20830024-20830046 AAAGGAGAACTGAGGGAGGGAGG - Intronic
973770489 4:54201906-54201928 TAGGGAAAACTAGGGGAGGTGGG + Intronic
974247611 4:59340740-59340762 AAGGGAGAAGGGAGGGAGGAAGG + Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
977435655 4:96990827-96990849 AAAGGTGGACTGAGGGAGGTGGG + Intergenic
977806800 4:101309175-101309197 AAGGGATGACAGAGGAAGGTGGG - Intronic
978669608 4:111230967-111230989 AGAGAATAAGTGAGGGAGGTAGG + Intergenic
979522106 4:121679440-121679462 AAGGAACAATTGAGGGAGGAAGG - Intronic
980369569 4:131849939-131849961 GAGGGATATCTGGGGGAAGTTGG - Intergenic
981094005 4:140760218-140760240 AAGAGAGAAGTGAGGGAGGGAGG - Intergenic
981104870 4:140868983-140869005 AAGGGTACACTGAGGTAGGTAGG + Intronic
981460348 4:145006840-145006862 AAGGGAGAAGTGAGAGAGGTGGG - Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982316513 4:154037467-154037489 AAGGAAGAAGGGAGGGAGGTGGG + Intergenic
982374436 4:154674187-154674209 AACGGATTACTGAAGGAGGTGGG - Intronic
982534750 4:156596317-156596339 AAGGGAGTACTGTGGGAGTTTGG - Intergenic
983325217 4:166245758-166245780 AAGGGATTACTTGGGGAGGGAGG + Intergenic
983434954 4:167701425-167701447 AGGGGATAAATGACTGAGGTTGG - Intergenic
983471930 4:168167774-168167796 AAGGCATAAATGAGGGAGCAAGG - Intronic
983500940 4:168499241-168499263 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986517250 5:8576460-8576482 AAGGGAAAAATGAGCGAGGCTGG - Intergenic
986548750 5:8928992-8929014 AAGAGATAAATGAGTGAGTTGGG - Intergenic
987915521 5:24207813-24207835 AAGGGATAACCCAGTGAGCTTGG - Intergenic
988552586 5:32210124-32210146 AAGGTATACCGGAGGGGGGTAGG - Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
990109200 5:52303277-52303299 AAGGGATAATTGAGGAAAGATGG + Intergenic
990297058 5:54412904-54412926 AAGGGACTATTGAGGGATGTAGG + Intergenic
991295709 5:65077986-65078008 AAAGGACAACTGAGCTAGGTGGG + Intergenic
993075489 5:83225428-83225450 AAGGGATAGCTGCTGGAAGTGGG + Intronic
994200729 5:96972834-96972856 AATGGATGACTGAGGGTGGGAGG - Intronic
994409395 5:99388088-99388110 AAGGGAAAAGGGAGGGAGGGAGG - Intergenic
995859206 5:116624008-116624030 CAGGAATGACTGTGGGAGGTGGG - Intergenic
996756877 5:126945007-126945029 AAGGGATGGATGAGGGAGGAAGG - Intronic
997886358 5:137633811-137633833 AAGGGATAAGTCTGGGAGGAGGG + Intronic
998946948 5:147350167-147350189 AAGGGATAGCGGGGGGCGGTGGG - Intronic
999142458 5:149371505-149371527 AAGGCATAATAGAGGGAGGCAGG + Intronic
999438300 5:151581443-151581465 GAGGGTTAGCTCAGGGAGGTAGG - Intergenic
999476065 5:151899864-151899886 CAGTCATAACTGTGGGAGGTAGG - Intronic
999920683 5:156316819-156316841 AAGGGCTGAATGAGGGAGATTGG + Intronic
1000477315 5:161727270-161727292 AAAGTTCAACTGAGGGAGGTGGG + Intergenic
1001048923 5:168398719-168398741 AAGACATAAATGAGGGATGTGGG + Intronic
1001234208 5:170015785-170015807 AAGGGAGAAAGGAGGGAGGGAGG - Intronic
1001283222 5:170403112-170403134 AAGGGACAAATGAGAGAGGGAGG - Intronic
1007168509 6:39845973-39845995 AAGGGGGAAATGAGAGAGGTTGG + Intronic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1009788514 6:68369281-68369303 AAGGAATAACTAAGGGAAGGAGG + Intergenic
1010704400 6:79090134-79090156 AAGGAATAAGGGAGGGAGGCAGG - Intergenic
1011152133 6:84286240-84286262 AAGGGAGAAAGGAGGGAGGGAGG - Intergenic
1012633413 6:101502993-101503015 GAGGAATAACAGATGGAGGTGGG + Intronic
1013743987 6:113322775-113322797 AAAGAATAACTGAGGGAAGTAGG + Intergenic
1016093599 6:140009078-140009100 AATGGAGAACTGAGGAAGGAGGG + Intergenic
1018902193 6:168057227-168057249 AAGGTATGGCTGAGTGAGGTGGG + Exonic
1019155958 6:170039169-170039191 AGGGGCTAACTCAGGGAAGTTGG - Intergenic
1019315528 7:382551-382573 AAGGGAGAAGTGAGGGAGGGAGG + Intergenic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019896762 7:3989084-3989106 ATAGGATAACAGAGGGAGGCCGG - Intronic
1021234340 7:18124012-18124034 AAGGGAAACCTGCTGGAGGTGGG - Intronic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1023626603 7:42121140-42121162 AGGGGAACACTGAGGCAGGTGGG - Intronic
1024886490 7:54148160-54148182 AAGGGGTACATGGGGGAGGTAGG + Intergenic
1026268524 7:68816452-68816474 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1028292342 7:89081064-89081086 AAGAGTTAACCGAGGGATGTTGG + Intronic
1028322166 7:89473704-89473726 ATGGGAAAACTGATGAAGGTTGG + Intergenic
1029745693 7:102514661-102514683 AAAGGAGAAATGAGAGAGGTGGG - Intronic
1029763632 7:102613640-102613662 AAAGGAGAAATGAGAGAGGTGGG - Intronic
1029993974 7:104988537-104988559 AAGGAATATGTGAGGGAGATTGG - Intergenic
1032282500 7:130515745-130515767 AAGGGATAAATGAATGAGGCTGG + Intronic
1033281136 7:140007258-140007280 AAGTGGTAACTGATGGAGGAGGG - Intronic
1033685488 7:143636569-143636591 AGGGGATGACAGAGGGAGGGAGG - Intronic
1033688658 7:143715787-143715809 AGGGGATGACAGAGGGAGGGAGG - Intronic
1033699126 7:143821051-143821073 AGGGGATGACAGAGGGAGGGAGG + Intergenic
1034226968 7:149491749-149491771 AAGGGAAAACCAAGGCAGGTGGG + Intronic
1035032208 7:155868846-155868868 AAGTGATAACTGATGGAAGTAGG + Intergenic
1036107213 8:5853972-5853994 AAGGGATACCTGTGGAATGTTGG + Intergenic
1036718066 8:11144993-11145015 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
1037486732 8:19354690-19354712 AAGGAATAACTGAGGGATGGAGG + Intronic
1037812455 8:22095144-22095166 AAGGGAAAAGTGAGGGATGCAGG - Intronic
1039197423 8:35048089-35048111 AAGACAAAACTGGGGGAGGTTGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041798644 8:61773569-61773591 AAGAGATCACTGAGCGAGGTGGG - Intergenic
1043209324 8:77491443-77491465 AAGGGAAGACTGAAGGTGGTGGG + Intergenic
1043280540 8:78460392-78460414 AATGGAGAACTGAGGCAGGGAGG + Intergenic
1043300588 8:78726087-78726109 AAGGGAAATGTGAGGGAGGGTGG + Intronic
1046221829 8:111226788-111226810 AAGGGAAAAGAGAGGGAGTTTGG - Intergenic
1046813679 8:118560203-118560225 AAGGCATGACTGAGGAAAGTAGG - Intronic
1047354088 8:124103846-124103868 CAGGGATGACTTAGCGAGGTTGG + Intronic
1047958487 8:129993904-129993926 GTGGGAGAATTGAGGGAGGTAGG - Intronic
1048360584 8:133694105-133694127 AAGGGATAACTGGGTCAGGGTGG + Intergenic
1048498081 8:134951849-134951871 ACGGGCTGACTGAGGGAGTTTGG + Intergenic
1049061252 8:140277853-140277875 ATGGGCAAACTGTGGGAGGTAGG + Intronic
1049186158 8:141255037-141255059 AAGGGAAAAGTGGGGGAGGTAGG + Intronic
1049620184 8:143594627-143594649 CAGGGAGAAGTCAGGGAGGTGGG + Intronic
1050952057 9:11609905-11609927 AAGGGATGACTGAGGAACCTAGG + Intergenic
1051665170 9:19462145-19462167 TATAGACAACTGAGGGAGGTGGG - Intergenic
1052827669 9:33188628-33188650 AAGGAATAAATGAGAGAGGCTGG + Intergenic
1055354718 9:75426242-75426264 AAGGAAGAAGCGAGGGAGGTAGG - Intergenic
1055797061 9:79986168-79986190 AAGGGAAATAGGAGGGAGGTGGG + Intergenic
1057852958 9:98579404-98579426 AGGGTTTGACTGAGGGAGGTGGG - Intronic
1057956347 9:99411199-99411221 AAGGGATCACAGAGGCTGGTAGG + Intergenic
1060525293 9:124316881-124316903 AAGGGAGAAATGAGAGGGGTTGG - Intronic
1061621666 9:131814675-131814697 AAGGCATGAGTGAGGGAGGGGGG + Intergenic
1185544846 X:935295-935317 AAGGTTGAACTGAGGGAGCTAGG + Intergenic
1186188353 X:7043545-7043567 AAGGAATACCTGAGTGAGGCTGG - Intergenic
1186320703 X:8421325-8421347 TTGTGATAACTGAGTGAGGTTGG + Intergenic
1186322379 X:8443044-8443066 AAGTAGAAACTGAGGGAGGTGGG + Intergenic
1187316124 X:18196812-18196834 AAGGGTGACCTGAGAGAGGTGGG + Intronic
1187834600 X:23418792-23418814 AATTGATAACTTAGGGAGGAAGG + Intergenic
1188988907 X:36792906-36792928 AATGGCTAACTGAAGGAGGTAGG + Intergenic
1189024422 X:37376841-37376863 TCAGTATAACTGAGGGAGGTGGG - Intronic
1189712795 X:43831545-43831567 AATGGATGACTGAGAGAGGGAGG + Intronic
1192180231 X:68911814-68911836 AAGGGCAAACTCAGGCAGGTGGG - Intergenic
1195943063 X:110180888-110180910 AAGGGACAACAGTGGCAGGTTGG - Intronic
1196238317 X:113308799-113308821 AAGAGAAAACTGAGGCAGATGGG - Intergenic
1198093906 X:133359231-133359253 AGGGCATTACTGAGGGAGTTCGG + Intronic
1198294225 X:135270106-135270128 GAGGGAGCAGTGAGGGAGGTGGG + Intronic