ID: 1103410730

View in Genome Browser
Species Human (GRCh38)
Location 12:120710117-120710139
Sequence CTTGGCCTGCCCATCACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 235}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103410721_1103410730 18 Left 1103410721 12:120710076-120710098 CCGGGCCCCGCAGGAGTGTGCAG 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410717_1103410730 22 Left 1103410717 12:120710072-120710094 CCCCCCGGGCCCCGCAGGAGTGT 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410716_1103410730 25 Left 1103410716 12:120710069-120710091 CCGCCCCCCGGGCCCCGCAGGAG 0: 1
1: 0
2: 1
3: 49
4: 400
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410720_1103410730 19 Left 1103410720 12:120710075-120710097 CCCGGGCCCCGCAGGAGTGTGCA 0: 1
1: 0
2: 2
3: 24
4: 311
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410722_1103410730 13 Left 1103410722 12:120710081-120710103 CCCCGCAGGAGTGTGCAGTCACC 0: 1
1: 0
2: 1
3: 7
4: 123
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410728_1103410730 -9 Left 1103410728 12:120710103-120710125 CCAGTTAGGCCTATCTTGGCCTG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410724_1103410730 11 Left 1103410724 12:120710083-120710105 CCGCAGGAGTGTGCAGTCACCCA 0: 1
1: 0
2: 2
3: 22
4: 184
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410723_1103410730 12 Left 1103410723 12:120710082-120710104 CCCGCAGGAGTGTGCAGTCACCC 0: 1
1: 0
2: 2
3: 14
4: 174
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410719_1103410730 20 Left 1103410719 12:120710074-120710096 CCCCGGGCCCCGCAGGAGTGTGC 0: 1
1: 0
2: 2
3: 16
4: 119
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410718_1103410730 21 Left 1103410718 12:120710073-120710095 CCCCCGGGCCCCGCAGGAGTGTG 0: 1
1: 0
2: 2
3: 15
4: 201
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235
1103410727_1103410730 -8 Left 1103410727 12:120710102-120710124 CCCAGTTAGGCCTATCTTGGCCT 0: 2
1: 0
2: 0
3: 10
4: 88
Right 1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG 0: 2
1: 0
2: 1
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103410730 Original CRISPR CTTGGCCTGCCCATCACTCC TGG Intergenic
901627762 1:10633373-10633395 CTTGCCCTCCCCTTCCCTCCTGG - Intergenic
901629507 1:10641341-10641363 CCTGCCCTGGCCATAACTCCTGG + Intronic
902117847 1:14136656-14136678 CCTGGCCTTCCCCTCCCTCCTGG - Intergenic
904942223 1:34172146-34172168 CTTGGCATACCTATCACTACTGG + Intronic
905508982 1:38503434-38503456 CATGGGCTGCCCCTTACTCCTGG - Intergenic
905972814 1:42154253-42154275 CTTGGCCTCCCCAACAGCCCTGG + Intronic
906318712 1:44803909-44803931 CTTTCCCTGCCCAACCCTCCAGG + Exonic
906480787 1:46197846-46197868 CCTGGCCAGCCCATGACTTCAGG + Exonic
911853701 1:102851515-102851537 CTTGGACAGCCCAGCCCTCCAGG + Intergenic
912440183 1:109691744-109691766 CGGGGCCTGCCCCTCACTCACGG + Intronic
916833213 1:168514096-168514118 GTTCACCTGCCCATCACACCAGG - Intergenic
917789860 1:178492585-178492607 CTGGGCCTCCCCATAACTCGTGG - Intergenic
919850059 1:201666573-201666595 CTTCCTCCGCCCATCACTCCTGG - Intronic
919887104 1:201942523-201942545 CTTGGCCTGCTTCTCCCTCCAGG - Intronic
922349402 1:224723151-224723173 CTTGCCCTGCCCAGCACCCTGGG - Intronic
1062945558 10:1458656-1458678 TTCTGCCTGCCCCTCACTCCAGG + Intronic
1063027214 10:2192233-2192255 CTTGGCCTCCCAATCACAGCTGG + Intergenic
1069082258 10:64100987-64101009 CTTGGCCTCCCAATCCCTTCTGG + Intergenic
1069662264 10:70131697-70131719 CCTGCCCAGCCCATCACTTCTGG + Intronic
1070333335 10:75433116-75433138 CTTGTCCAGCCCCTCCCTCCAGG - Intronic
1070831291 10:79419564-79419586 CTTGGCCTGCCCCTCTCACATGG - Intronic
1071454660 10:85836792-85836814 CTTGGCCTGCTTACCTCTCCTGG + Intronic
1072249202 10:93568369-93568391 CTTGGCCTCCCCTTCCCTGCCGG + Intronic
1074336373 10:112580534-112580556 CTTGGTCTGCCAAGCAATCCTGG - Intronic
1076742922 10:132496946-132496968 CATGGCCTGCTCCCCACTCCAGG + Intergenic
1077890305 11:6413489-6413511 CAGGGCTTGCCCATCTCTCCAGG + Intronic
1080560524 11:33458504-33458526 CTGAGCCTGCCCATCATTGCAGG - Intergenic
1080845177 11:36020733-36020755 CCTGGCCAGCCCACCTCTCCAGG - Intronic
1081701918 11:45157743-45157765 CATGGCCAGCCCATGACCCCAGG - Intronic
1082831582 11:57622463-57622485 CATGGCCAGCCTGTCACTCCAGG - Intergenic
1084323600 11:68386735-68386757 CTTGGCCTGGCCCTGGCTCCAGG - Intronic
1084392994 11:68890805-68890827 CCTGTCCTGCCCAGCCCTCCTGG + Intergenic
1090860450 11:130648026-130648048 CTTGGCCTCCCAATCACACTGGG - Intergenic
1090878883 11:130815886-130815908 CTTGCTCTGCCCCTCACTCAGGG - Intergenic
1091103197 11:132894851-132894873 CTTGGCCTGAACAACACTACTGG + Intronic
1091542847 12:1478164-1478186 CTTGGCCTCTCCTACACTCCCGG - Intronic
1091618385 12:2067053-2067075 CTAGGAATGCCAATCACTCCTGG - Intronic
1095982885 12:47982864-47982886 CGTGGCCTCCCCGGCACTCCTGG - Exonic
1096087966 12:48878992-48879014 CTTGGCCAAGCCACCACTCCTGG - Intergenic
1096543972 12:52324249-52324271 CTGTGCCTGCCCTTCACACCTGG + Intergenic
1097241088 12:57575722-57575744 CTTGGCCAGCTCATCGCTCAAGG - Exonic
1099044370 12:77697310-77697332 TTTGACCTGCCCATCACTGTTGG - Intergenic
1101813287 12:108126449-108126471 CTTGGTCTCCCAAGCACTCCTGG - Intergenic
1102036515 12:109773496-109773518 CTGCGCCTGCCCATCCCTCCCGG + Intergenic
1102256028 12:111415471-111415493 CTTTGCCTGCCCATCTCAACTGG - Intronic
1102349869 12:112184398-112184420 CTCGAGCTGCCCATCCCTCCGGG - Exonic
1102477841 12:113200475-113200497 CCTGCCCTGCCCAACACTGCTGG + Intronic
1103410730 12:120710117-120710139 CTTGGCCTGCCCATCACTCCTGG + Intergenic
1103411101 12:120711618-120711640 CTTGGCCTGCCCATCACTCCTGG + Intronic
1103560901 12:121793023-121793045 CTTGGCCGGCTCTTCACTCCTGG - Intronic
1104756402 12:131272352-131272374 CCTCGCCTGGCCTTCACTCCCGG + Intergenic
1105500057 13:20964054-20964076 CTTGGCCTCCCCAGCACTTTGGG + Intergenic
1106508466 13:30392351-30392373 CTGGGCATGCCCTTCACTCTGGG - Intergenic
1107718747 13:43226660-43226682 CTTCTCCTGCCCATCACTTGTGG - Intronic
1108693945 13:52886232-52886254 CTTCGGCTGACTATCACTCCAGG + Intergenic
1109007730 13:56900774-56900796 CTTGGCGGGCCCCGCACTCCGGG + Intergenic
1110085961 13:71380107-71380129 CTTGGGCTGCCTCTCCCTCCGGG - Intergenic
1110687334 13:78390226-78390248 ATTGGCCTTCCAAGCACTCCTGG + Intergenic
1112164073 13:96898984-96899006 CTTGCTCTGACCATTACTCCTGG - Intergenic
1112182335 13:97096092-97096114 CTGGGCCTGCCCTTCACGCGTGG - Intergenic
1114058890 14:19001227-19001249 GGTGGCCTGCCCCTCTCTCCAGG - Intergenic
1114103654 14:19400527-19400549 GGTGGCCTGCCCCTCTCTCCAGG + Intergenic
1116186038 14:41601789-41601811 CCTGTCCAGCCCACCACTCCTGG + Intergenic
1116849020 14:49890822-49890844 CAAGGCCTGCCCATCACTTGAGG + Intergenic
1118569904 14:67183985-67184007 CTGGGACTACCCATCACACCTGG + Intergenic
1121093424 14:91199118-91199140 CTTGGCCTGGCTATCCCTGCTGG + Intronic
1122073606 14:99221572-99221594 CCTGGCCTGCCCCTCCCGCCTGG - Intronic
1122874789 14:104659114-104659136 CTGGGCCTGCATATCCCTCCCGG - Intergenic
1123430966 15:20215999-20216021 CCTCGCCTGCCCAAGACTCCTGG - Intergenic
1124476467 15:30039238-30039260 CTTGGTCTTCCCATCCTTCCAGG + Intergenic
1124832966 15:33167174-33167196 CCTGGCCTGCCCATGACACGTGG - Intronic
1126073152 15:44883465-44883487 CCTGGCCTGCCCAACACACAGGG + Intergenic
1126085109 15:45004173-45004195 CCTGGCCTGCCCAACACACAGGG - Intergenic
1128478279 15:68016036-68016058 CTTGGCCATCCCATAGCTCCAGG + Intergenic
1129238720 15:74239410-74239432 CTAGGACTGCCCATCACTTAGGG - Intronic
1131178223 15:90223441-90223463 CTTCTCCTGCCCTTCAGTCCTGG + Intronic
1131682334 15:94737204-94737226 CTTGGCCTGCCCATCCACCCTGG + Intergenic
1136490441 16:30604518-30604540 CTTTGCCTACCCCTCACTGCTGG - Exonic
1136506526 16:30707627-30707649 CTTGGCCTGCTCCTCCCTCCGGG - Exonic
1136853688 16:33635248-33635270 CCTCGCCTGCCCAAGACTCCTGG + Intergenic
1138768752 16:59636407-59636429 CTTTGCCTTCCAATCACTACTGG - Intergenic
1139549688 16:67666553-67666575 CCTGGCGTGCCCGCCACTCCCGG + Exonic
1140985442 16:80154100-80154122 CTTCTCCTTCCTATCACTCCAGG + Intergenic
1142135239 16:88449023-88449045 CTGGGCCTGCCCTGCACTCTGGG + Intergenic
1142210604 16:88806689-88806711 CTTGGGCAGCCCATTTCTCCCGG + Intronic
1142252961 16:89001183-89001205 CTGGGCCTGCCCATCCCCCAGGG + Intergenic
1203115279 16_KI270728v1_random:1483693-1483715 CCTCGCCTGCCCAAGACTCCTGG + Intergenic
1142602348 17:1059955-1059977 CCTGCCCTGCCCATCCCACCTGG + Intronic
1145960635 17:28884743-28884765 CTTGGTCTACCCAGCACCCCAGG + Intronic
1146146648 17:30424701-30424723 CTGGGCAAGCCCATCTCTCCTGG + Intronic
1147137690 17:38443665-38443687 CCAGCCCTGCCCATCCCTCCCGG - Intronic
1147463426 17:40590817-40590839 GGTGGCCTGCCTATCACTCTGGG - Intergenic
1147885743 17:43683302-43683324 CCTGGCCTGCCCACAACCCCAGG + Intergenic
1150621610 17:66812026-66812048 CTGGCCCTGACCTTCACTCCGGG + Intergenic
1151259666 17:72906535-72906557 CTTGGCCTAGGCATCATTCCAGG - Intronic
1152515909 17:80824888-80824910 CCTCGCCTGCTCATCCCTCCTGG - Intronic
1153771533 18:8420817-8420839 CTAGGTCTGCCCTTCACTCAAGG + Intergenic
1155112672 18:22731843-22731865 CCTGGTCTCCCCATTACTCCTGG - Intergenic
1155741970 18:29299490-29299512 CTTGGCCTCCCCTTCATTCAAGG + Intergenic
1156514904 18:37671270-37671292 CATGGCCTGCCAATGTCTCCTGG - Intergenic
1159954058 18:74507194-74507216 CTTGGCCGTGCCCTCACTCCTGG + Intronic
1160659095 19:290180-290202 CTCGGCCTGGCCACCACCCCTGG + Intronic
1160928208 19:1556928-1556950 CTTGTCCTTCCCCTCCCTCCCGG - Intronic
1161575355 19:5051784-5051806 CTTGACCTGCCCATGACCCGCGG + Intronic
1161578523 19:5067864-5067886 CTTTGCCTGCCCGTGACCCCAGG - Intronic
1161733710 19:5977863-5977885 CCGGCCCGGCCCATCACTCCCGG - Intronic
1162534106 19:11253147-11253169 CCTGCCCTGCCCCTCCCTCCAGG + Intronic
1163095138 19:15051850-15051872 CTTGCCCTGCTCCTCATTCCAGG + Intronic
1165553122 19:36605355-36605377 CTTGGCCTCCTCAGCACCCCTGG - Intronic
1167345547 19:48943438-48943460 CTTGGCCTCCCAATCACGCTGGG - Intronic
1167743796 19:51339728-51339750 CTGGGCCGGCCCGTCAGTCCTGG + Intronic
925286143 2:2716937-2716959 CTCGGCCTCTCCATCCCTCCTGG - Intergenic
928841001 2:35604588-35604610 ATTGGCCTGCAGATCACTGCAGG + Intergenic
930570039 2:53074988-53075010 ATTTGCCAGACCATCACTCCTGG + Intergenic
931664767 2:64602277-64602299 GGTGGCCTGTGCATCACTCCTGG + Intergenic
932056370 2:68447941-68447963 CTTGGCCTGCCCATTGGCCCAGG + Intergenic
932564694 2:72898471-72898493 CTTGGCTGGCCCAGCCCTCCAGG + Intergenic
932932724 2:76061550-76061572 TTTGGCCTGGACATTACTCCAGG + Intergenic
934138439 2:89020246-89020268 CTCTCCCTGCCCATCACCCCTGG - Intergenic
934224737 2:90122275-90122297 CTCTCCCTGCCCATCACCCCTGG + Intergenic
934230816 2:90180379-90180401 CTCTCCCTGCCCATCACCCCTGG + Intergenic
934571607 2:95376234-95376256 CTTTCCCTGCCCCTCTCTCCTGG + Intronic
935538473 2:104322117-104322139 CTTGGCCTGCTCCTCTATCCTGG - Intergenic
937020422 2:118646003-118646025 CTCGGCCTCCCAATCACTCCTGG + Intergenic
938308006 2:130267749-130267771 CCTGGCCTGCCCATCACTGCTGG - Intergenic
938465452 2:131522015-131522037 TTTTGCCTGCCCCCCACTCCTGG - Intergenic
942452140 2:176114973-176114995 CCTGGCCGGCCCCTCACTCAGGG + Intronic
946069224 2:217017042-217017064 CTTGGGCTGCCCACTAATCCTGG - Intergenic
947205091 2:227653637-227653659 CTTGGCCTGCCCGTTTTTCCTGG + Intergenic
948369642 2:237480529-237480551 CTAGGCCTCCCCCTCACTCATGG - Intergenic
948636812 2:239343595-239343617 CTTGGCCTCCACATCCCTCAGGG + Intronic
948731183 2:239964643-239964665 TCTGGCCTGCCCCTCCCTCCGGG - Intronic
1169027575 20:2383491-2383513 CAGGCCCTGCCCATCACTTCTGG - Intronic
1169211137 20:3766973-3766995 CTTGGGCTGCACCTCCCTCCCGG - Intronic
1170578653 20:17682095-17682117 CTTGGCCGGCTCCTCTCTCCCGG - Exonic
1172031486 20:31985142-31985164 CTACCCCTGCCCATCAGTCCTGG + Intronic
1172101034 20:32483992-32484014 CTGTGCCTACCCATCGCTCCCGG + Intronic
1175305611 20:57973739-57973761 CTTGGACTGGACATCACTGCTGG - Intergenic
1175483446 20:59327570-59327592 CTCGGACTGCCCATGACTCCTGG - Intergenic
1176124555 20:63469692-63469714 CCTGGCCTTCCCCCCACTCCCGG + Intronic
1176197655 20:63844767-63844789 CATGCACTGCCCATCCCTCCTGG + Intergenic
1180477375 22:15723843-15723865 GGTGGCCTGCCCCTCTCTCCAGG - Intergenic
1181582042 22:23833950-23833972 CAGGCCCTGCTCATCACTCCAGG - Intronic
1181803080 22:25359789-25359811 CTTGGCCTGGCCCTGGCTCCAGG + Intronic
1182930321 22:34167404-34167426 GTTGTCCAGCCCATCACTACTGG - Intergenic
1183324416 22:37183690-37183712 CTTGCCCTGCCCAGCTCTCTGGG - Intronic
1183332252 22:37228005-37228027 ATTGTCTTGCCCATCCCTCCAGG + Intronic
1184218761 22:43085433-43085455 CTTGCCCTGCCCTTGACTCGTGG - Intronic
1185003777 22:48263271-48263293 CTTGGTATGCCCATCTCACCAGG - Intergenic
1185074535 22:48676231-48676253 CTTGGCCTGTCCCTCCCACCTGG + Intronic
1185120965 22:48969802-48969824 CTTGGCCTGCCTAAGTCTCCTGG - Intergenic
1185278103 22:49958502-49958524 CCTGCCCTGCCCTCCACTCCAGG + Intergenic
1185287416 22:50008728-50008750 CCTGCCCTGTCCCTCACTCCTGG + Intronic
949245670 3:1923410-1923432 CCTGGCCTTCCCATCATTCAAGG - Intergenic
950086299 3:10260396-10260418 CTTGGCTGGTCCTTCACTCCTGG - Exonic
950566495 3:13772606-13772628 CTTGTTCTCCTCATCACTCCAGG - Intergenic
950939191 3:16876377-16876399 CTTGGGCTGCCCATCTTCCCTGG + Intronic
951492725 3:23290801-23290823 CTTGGCCTCCCCAGAACTGCTGG - Intronic
952662437 3:35868015-35868037 CTTTGCCTTCCCTTCACTCAAGG - Intergenic
953406179 3:42660889-42660911 CTTGTCCTGCCCATCTATGCAGG - Intronic
954197500 3:49005334-49005356 CTTGTCCTGCCCATTCCTCCAGG + Intronic
959990348 3:112624416-112624438 CATGGACTGCTCAGCACTCCTGG - Intronic
961009882 3:123428637-123428659 CTGGGACTCCCCATCACTTCAGG + Intronic
961509004 3:127389955-127389977 CTGGCCCTGCCCATTCCTCCAGG - Intergenic
962312758 3:134337749-134337771 CTTGGCCTACACAGCCCTCCTGG + Intergenic
962422722 3:135242245-135242267 CTTGCCCTTCCCATCACTTTGGG + Intronic
962839539 3:139221475-139221497 CTTGGCCAGCCCCCGACTCCAGG - Intronic
962889250 3:139657135-139657157 CCTGGCCGGCCCTTCACTACAGG - Intronic
963657732 3:148079458-148079480 CTTGGCCTGCCCTGTCCTCCTGG - Intergenic
965051231 3:163651011-163651033 CTTTGCATACCCATTACTCCTGG + Intergenic
966892297 3:184416340-184416362 CTTGGCCTGGCACTCACTGCAGG - Intronic
968565956 4:1312969-1312991 TCTGGCCTGGCCAACACTCCAGG - Intronic
970678137 4:18476564-18476586 CTTGTCCTGCCCTTGACTCATGG + Intergenic
976211909 4:82680243-82680265 TCTGCCCTGCCCATCACTCATGG - Intronic
985784857 5:1888117-1888139 CTTGCCCTGCCCCTCCCTCAGGG + Intergenic
985813535 5:2109561-2109583 CTGGGCTTCCACATCACTCCTGG + Intergenic
986031219 5:3894354-3894376 CTGGCCCTGCCCCTCACTCAGGG + Intergenic
989720816 5:44525888-44525910 GGTTTCCTGCCCATCACTCCTGG + Intergenic
991157679 5:63458461-63458483 GGTGGCCTGCCCCTCACTCCAGG - Intergenic
991975256 5:72178577-72178599 CATGCCCTGCCCCTCAGTCCTGG + Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
994984621 5:106917223-106917245 CCTGGCCTACCCTTCATTCCAGG + Intergenic
995099286 5:108278801-108278823 CATGGCCTCCCCATCACAGCTGG + Intronic
997638981 5:135436061-135436083 CTTGGAATGCCCCTCCCTCCAGG - Intergenic
997872117 5:137515397-137515419 CTTGGCCGACCCAGCACCCCCGG - Intronic
999460996 5:151757731-151757753 CTTAGGCTCCCCATCTCTCCAGG - Intronic
1001315900 5:170641188-170641210 CATGGCTTCCCCATCACTCTGGG + Intronic
1002649974 5:180684223-180684245 CCTGCCCTGCCCATCCCTCCAGG - Intergenic
1004268754 6:14174995-14175017 TTTGGCCTGACCATTACCCCAGG - Intergenic
1006255460 6:32829169-32829191 CCTGGACTGCCCTTCTCTCCCGG + Intronic
1007711823 6:43829115-43829137 CTTGCCCTGCCCACTTCTCCGGG - Intergenic
1007787658 6:44290529-44290551 CTTGCCCTTCACATCACTCCTGG - Intronic
1008001463 6:46364792-46364814 CTTGGCATGCCAAGGACTCCAGG - Intronic
1010821361 6:80419395-80419417 CTTGGTCTGCCGGTCTCTCCTGG - Intergenic
1011154095 6:84310293-84310315 CTCGACCTGCCTATCACTGCTGG - Intergenic
1011733804 6:90293556-90293578 CTAGGCCAGCCCTTCACTTCTGG - Intronic
1017370122 6:153695084-153695106 CTTGGCCTCGCCATCTCTCTGGG + Intergenic
1019428361 7:987717-987739 CTTGGCCTGGCCAGCAGACCTGG + Intronic
1020027737 7:4911075-4911097 TCTGGCCTCCCCAGCACTCCTGG - Intronic
1020088221 7:5323043-5323065 CCTGGCCAGCCCATCACCGCAGG + Intronic
1022704125 7:32787264-32787286 CTGGGCCTGCCCCCCACTCCTGG + Intergenic
1022908306 7:34877006-34877028 CTGGGCCTGCCCCCCACTCCTGG + Intronic
1022973200 7:35535880-35535902 CTGGGCCTTCACCTCACTCCTGG - Intergenic
1023227298 7:37983974-37983996 CTTGCCCTTCCCGTCAGTCCTGG - Intronic
1024028178 7:45432188-45432210 CTGGGCCAGCCCTCCACTCCTGG - Intergenic
1024295996 7:47842783-47842805 CTTGGCCTGCACATCTGTCAGGG - Intronic
1025206090 7:56994070-56994092 CCTGGCCAGCCCATCACCGCAGG - Intergenic
1025665850 7:63582869-63582891 CCTGGCCAGCCCATCACCGCAGG + Intergenic
1028806346 7:95030899-95030921 CTGGGCCTGCCCTTTCCTCCTGG + Intronic
1028989986 7:97038558-97038580 ATTGGTCTGCCCAACACTCCTGG + Intergenic
1029673410 7:102049586-102049608 CTCGGCCTCTCCATCACACCTGG - Intronic
1029732469 7:102447324-102447346 CGGGACCTGCCCATCAGTCCTGG + Exonic
1031726633 7:125247930-125247952 CCTGTCCTGCCTATCACTTCCGG - Intergenic
1032179020 7:129659710-129659732 CATGGCCTGCCCCCCTCTCCCGG + Intronic
1032923625 7:136577300-136577322 CCTGGCCTCCCCTTCACTCAAGG + Intergenic
1033074464 7:138235476-138235498 CTTGGCCTCCCAATCACACTTGG - Intergenic
1033109272 7:138560310-138560332 TTTGGACTGCCCTTGACTCCAGG - Intronic
1034947253 7:155270463-155270485 CCTGCCCTGCCCTTCACTCCTGG - Intergenic
1035140341 7:156753188-156753210 CATGTCCTTCCCATCACTCCAGG - Intronic
1035660699 8:1345643-1345665 CCTGTCCTGCCCATCCCTCAGGG - Intergenic
1036135837 8:6160813-6160835 CTTGGGCACCCCCTCACTCCTGG + Intergenic
1039311822 8:36324593-36324615 CTTGGCATGCTAATCACACCAGG + Intergenic
1042390597 8:68229326-68229348 CTTGGTCTGCCCATCATTTGGGG - Intronic
1042491611 8:69405880-69405902 ATTGGCCTGCTGATCAGTCCTGG - Intergenic
1042519479 8:69696087-69696109 CTGGGCTTGCCCAGCACTGCTGG - Intronic
1044313739 8:90726362-90726384 CTTGGCCTGCTGGTCTCTCCTGG + Intronic
1048156015 8:131952560-131952582 CTTGGCCTTCTCATCACCCAAGG + Intronic
1048272055 8:133037319-133037341 CTTGGACTCCCCATCTTTCCTGG + Intronic
1048572287 8:135666113-135666135 CCTGTGCTGCCCAGCACTCCAGG - Intergenic
1049174987 8:141186782-141186804 CCTGCCCTGCTCATCCCTCCAGG + Intronic
1049339984 8:142106897-142106919 CTTGGCCTGGCCATGGCCCCTGG + Intergenic
1049384002 8:142331714-142331736 CTGGGCCTGCCCCTCCATCCAGG - Intronic
1049794778 8:144492120-144492142 CTGGGCCAGCCCGTCACTGCCGG + Intronic
1049944537 9:581089-581111 CCTGGCCTACCCAGAACTCCTGG + Intronic
1051365188 9:16316840-16316862 CCGGGGCTGCCCATCACTGCTGG + Intergenic
1052916392 9:33926947-33926969 CCTGGCCTGCCCAGCTCCCCTGG - Intronic
1053122710 9:35558602-35558624 CTTGCCCTGCCCCCCACCCCCGG + Intronic
1059448886 9:114357656-114357678 CTGAGCCTGCCCATCACAGCTGG - Intronic
1060354197 9:122888923-122888945 CTTTGCATGCCCATGACTACTGG + Intronic
1060508835 9:124217689-124217711 CTTGCCCTTCCCAGCACCCCTGG + Intergenic
1060814971 9:126630388-126630410 CTTGGCCTGAACAACTCTCCTGG + Intronic
1062096438 9:134706283-134706305 CTGGGCCTGCCCAGCACCTCTGG - Intronic
1062540820 9:137040924-137040946 CTGGGCCTCCCCTCCACTCCAGG - Exonic
1062635286 9:137487365-137487387 CTTGGCCAGCCCTGCACTCCAGG - Intronic
1187310136 X:18133932-18133954 CCAGGCCTGGCCCTCACTCCTGG + Intergenic
1188188477 X:27145271-27145293 CTTAGCCTCCCCATCAGTCAGGG - Intergenic
1188797090 X:34480888-34480910 CTTGGCCTCTCTATCACTCCAGG - Intergenic
1189339303 X:40192480-40192502 CTTGGTCAGCCAATCACTCTTGG + Intergenic
1189693335 X:43639050-43639072 CTTGGCCTTCCCGTAACACCAGG + Intergenic
1190482367 X:50889946-50889968 CTTGCCCTGCCCACCACAGCTGG + Intergenic
1190952557 X:55161219-55161241 CTTGGCCAGCCCCGCCCTCCGGG - Intronic
1196192052 X:112804968-112804990 CTTGGCCTGGGCATTACTCAGGG + Exonic
1197924037 X:131627732-131627754 CTTGGCCTCCCTACTACTCCAGG - Intergenic
1199880489 X:151970769-151970791 CTCTGCCTGCTCCTCACTCCTGG - Intronic
1202047546 Y:20749821-20749843 CTGGGCCTACCCTTCACACCTGG + Intergenic