ID: 1103411064

View in Genome Browser
Species Human (GRCh38)
Location 12:120711270-120711292
Sequence TGCCACGGCTATGTGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103411064 Original CRISPR TGCCACGGCTATGTGTTTTG AGG (reversed) Intronic
900611825 1:3547497-3547519 TGCCACAGCTGTGGGTTTTCAGG + Intronic
900924319 1:5693690-5693712 TGCCACGGGCATTTGTTTTCGGG - Intergenic
901962948 1:12841624-12841646 TGCCAGTGCTATGAGTTTAGTGG - Intergenic
901990139 1:13105930-13105952 TGCCAGTGCTATGAGTTTAGTGG - Intergenic
902691783 1:18114344-18114366 AGCACCTGCTATGTGTTTTGTGG - Intronic
902937158 1:19772690-19772712 TCCCAAGGCAATGTGGTTTGAGG - Intronic
903077134 1:20779692-20779714 TTTCATGGCTAAGTGTTTTGGGG - Intronic
906095873 1:43223539-43223561 TTCCAGGGCTAAATGTTTTGGGG - Intronic
906309504 1:44743278-44743300 TGCCACTGCTTTGTGTTCTCAGG + Intronic
908662999 1:66457586-66457608 TGCCACGGCTGAGTGTTTTAGGG - Intergenic
912514226 1:110208002-110208024 TTCCCCGGCTCTGTGTTTTGAGG + Intergenic
916317128 1:163461669-163461691 TGCCATGACTATGTCGTTTGGGG + Intergenic
1065206703 10:23363925-23363947 TGCCAGTCCTCTGTGTTTTGTGG + Intergenic
1066790357 10:39055597-39055619 TGACACTGCTTTGTGATTTGTGG + Intergenic
1075588774 10:123676652-123676674 TGCCTGGGCTTTGTGTCTTGTGG - Intronic
1075799434 10:125143923-125143945 GCCCAGGGCTAGGTGTTTTGGGG - Intronic
1086130769 11:83399941-83399963 TGTCATTGCTATGTGTTTGGAGG + Intergenic
1086429125 11:86718280-86718302 TGCCAAAGCTCTGTGCTTTGGGG + Intergenic
1086613770 11:88789666-88789688 TGCCACTGGTGTGTGGTTTGAGG - Intronic
1090513886 11:127404037-127404059 TGCAACAGGTATGTGTTTAGGGG - Intergenic
1093591727 12:20909499-20909521 TGCCACCTCTATATTTTTTGTGG + Intronic
1101670631 12:106868955-106868977 TGACAAGGCTATGGGTTTTCAGG + Intronic
1102629515 12:114265456-114265478 TGCCACCCCAATGTGTTGTGGGG - Intergenic
1103411064 12:120711270-120711292 TGCCACGGCTATGTGTTTTGAGG - Intronic
1104213551 12:126713822-126713844 TGCCTCAGCTGTGTGTTTTAGGG + Intergenic
1119995876 14:79253147-79253169 TGCCTTGTCTGTGTGTTTTGGGG + Intronic
1120930015 14:89838983-89839005 TGGCAGGGCTTTGAGTTTTGGGG + Intronic
1133210033 16:4258338-4258360 TTTCTGGGCTATGTGTTTTGGGG - Intronic
1136060670 16:27724185-27724207 TGCCATGGCTATGTGGGCTGGGG - Intronic
1138171439 16:54853344-54853366 TGCCACTGCTATCTGTTCTGAGG + Intergenic
1139406466 16:66722949-66722971 GTCCACGGATATGTGTTGTGGGG - Exonic
1140838887 16:78820668-78820690 TGCCACGTGTATGTGTTTCCTGG + Intronic
1142186942 16:88699110-88699132 TGGCACGGCTAGGTGTCTAGGGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142852247 17:2709908-2709930 GGGCACAGCTATTTGTTTTGGGG - Intronic
1149780825 17:59395141-59395163 TTCCACGGTAATGTGTTTGGGGG - Intronic
1154193697 18:12251037-12251059 TGCCCTGGCTATGTGTTTAACGG + Intergenic
1155378240 18:25186129-25186151 TGCCGAGGCAATGTGTTATGGGG + Intronic
1157396266 18:47344263-47344285 TGTCATGACTATGTATTTTGGGG - Intergenic
1157416885 18:47510845-47510867 TGCCAGAGGTGTGTGTTTTGGGG + Intergenic
1163128504 19:15257525-15257547 AGCCTCGGCTAACTGTTTTGGGG - Intronic
927642348 2:24853202-24853224 AGCCAGTGCGATGTGTTTTGAGG + Intronic
929124999 2:38515301-38515323 TGCCACCTGTATGTCTTTTGCGG - Intergenic
931062851 2:58550141-58550163 TGTAACAACTATGTGTTTTGGGG + Intergenic
934947858 2:98554850-98554872 TTCCAGGGCTATGTGTATTTGGG + Intronic
934982115 2:98851213-98851235 TCCCAAGGCTGTGGGTTTTGAGG + Intronic
936982166 2:118275050-118275072 AGCCTCGGCTACATGTTTTGAGG + Intergenic
937734207 2:125270178-125270200 TGCCAGGCCTCTTTGTTTTGTGG + Intergenic
939742614 2:145928535-145928557 TGTTATGGATATGTGTTTTGTGG + Intergenic
942972469 2:181973094-181973116 TGCCACAGCAACCTGTTTTGGGG - Intronic
945968657 2:216215288-216215310 TGCCTCCGCTAGGTGTTTTAAGG - Intergenic
946858837 2:223980468-223980490 TGCCATGGCTTTGAGCTTTGAGG - Intronic
1171896079 20:30812070-30812092 TGCCACGGCCCAGTGTTTCGCGG - Intergenic
1173778627 20:45734850-45734872 TGCCTTGGCTATTTTTTTTGTGG - Intergenic
1174593703 20:51667061-51667083 TGACACAGCTGTGTGTTGTGGGG - Intronic
1179332787 21:40421551-40421573 TGCCAGCGCTGTGTGTTTTGAGG + Intronic
1181167547 22:20991716-20991738 CGCCACCTCTATGTGTTTGGGGG + Exonic
949545251 3:5066938-5066960 TGCCTCAGCTGTGTGATTTGGGG + Intergenic
950024086 3:9809011-9809033 TGCCTCTGCTCTGTGATTTGAGG + Intronic
951144804 3:19214365-19214387 AGGGACAGCTATGTGTTTTGTGG - Intronic
953716923 3:45323564-45323586 TGCCATATCTATGTGATTTGGGG - Intergenic
959283824 3:104381543-104381565 TGGCACGTGTGTGTGTTTTGGGG - Intergenic
961340030 3:126211845-126211867 TGCCAGGGCTATAAGTCTTGTGG - Intergenic
963850843 3:150209029-150209051 GGCCAAAGTTATGTGTTTTGTGG + Intergenic
964062361 3:152539082-152539104 TGACCTGGCTGTGTGTTTTGTGG + Intergenic
964426300 3:156557478-156557500 TGCCACGGCTATGTGTGCCACGG - Intergenic
969279154 4:6158020-6158042 TTCCAGGGCTATGTGCTATGAGG + Intronic
974835593 4:67245746-67245768 TGCCTAAACTATGTGTTTTGGGG + Intergenic
978253106 4:106657285-106657307 TACAGTGGCTATGTGTTTTGGGG + Intergenic
982518295 4:156380627-156380649 AGACTGGGCTATGTGTTTTGGGG - Intergenic
990167971 5:53016546-53016568 TCCGATGACTATGTGTTTTGGGG + Intronic
991579385 5:68138340-68138362 TGGGAAGGCTATGTGTGTTGGGG - Intergenic
994751508 5:103743436-103743458 TGCCACATCAATGAGTTTTGTGG - Intergenic
994988398 5:106967241-106967263 AGCCAGGGGTATGTGTTTGGCGG - Intergenic
995479945 5:112583626-112583648 TCCCAGGGCCATGTGTTTTCCGG - Intergenic
1000298652 5:159935108-159935130 TGAATGGGCTATGTGTTTTGAGG + Intronic
1002845534 6:941313-941335 TGGAACGGCCATGTGTGTTGAGG + Intergenic
1008182832 6:48354301-48354323 TACCAGGGTTATGAGTTTTGGGG + Intergenic
1012848288 6:104417588-104417610 GGCCACTGGTTTGTGTTTTGTGG + Intergenic
1014503237 6:122220633-122220655 TGACAAGTCTATGTGTTATGTGG + Intergenic
1017349061 6:153418541-153418563 CTCCACGGATTTGTGTTTTGGGG - Intergenic
1027784871 7:82568092-82568114 TGCCATGGTTTTCTGTTTTGGGG - Intergenic
1029031245 7:97469505-97469527 TGCCATAGCTGTGTGTTTTTGGG - Intergenic
1032607097 7:133367404-133367426 TGCCGCGGCTATTTGATTAGAGG + Intronic
1038999274 8:32961623-32961645 TTCCACTGCTATGTGTATTCTGG - Intergenic
1041563092 8:59242962-59242984 TGGCAAGGCTATGTGATATGGGG - Intergenic
1044301713 8:90591828-90591850 TGCCTCTGCTATGTGTTCCGTGG - Intergenic
1046170261 8:110496917-110496939 TGCCATGATTATGTGTTCTGAGG + Intergenic
1047573594 8:126129425-126129447 AGCCACGGGTAGGTGTGTTGGGG + Intergenic
1049266676 8:141671354-141671376 TGCCAGGGCTATGAGTCTAGAGG + Intergenic
1051191537 9:14518240-14518262 GGCCATGGCCCTGTGTTTTGGGG + Intergenic
1051436299 9:17036342-17036364 TTTTAGGGCTATGTGTTTTGGGG + Intergenic
1056561246 9:87731855-87731877 TGCCAAGGCTGTTTGTTTTTGGG + Intergenic
1059677410 9:116552688-116552710 TGACTCTGCTATGTGTTCTGGGG + Intronic
1059788276 9:117611064-117611086 TCCCTTGGCTAGGTGTTTTGGGG - Intergenic
1061225972 9:129281200-129281222 TGCCAGGGCCCTGTGTTGTGGGG + Intergenic
1188101613 X:26094898-26094920 TTCATGGGCTATGTGTTTTGTGG + Intergenic
1188869275 X:35353828-35353850 TCTCATGTCTATGTGTTTTGGGG - Intergenic
1197881393 X:131170550-131170572 TGCCACTGGTATCTGATTTGGGG - Intergenic
1198483741 X:137065646-137065668 TTACACTGCTATGTGTTTTGGGG + Intergenic
1199509805 X:148609369-148609391 TGCCATGGAAATGTGGTTTGAGG + Intronic
1201490794 Y:14539247-14539269 AGACAGGGATATGTGTTTTGGGG + Intronic