ID: 1103425362

View in Genome Browser
Species Human (GRCh38)
Location 12:120829504-120829526
Sequence GGGAATCGCTTGGACCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225217
Summary {0: 1, 1: 44, 2: 2827, 3: 57304, 4: 165041}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103425349_1103425362 29 Left 1103425349 12:120829452-120829474 CCGGCATGATGGTATATACCTGC 0: 1
1: 0
2: 3
3: 26
4: 348
Right 1103425362 12:120829504-120829526 GGGAATCGCTTGGACCTAGGGGG 0: 1
1: 44
2: 2827
3: 57304
4: 165041
1103425351_1103425362 11 Left 1103425351 12:120829470-120829492 CCTGCAGTCCCAGCTACTCTGGA 0: 134
1: 7495
2: 114435
3: 241381
4: 241028
Right 1103425362 12:120829504-120829526 GGGAATCGCTTGGACCTAGGGGG 0: 1
1: 44
2: 2827
3: 57304
4: 165041
1103425348_1103425362 30 Left 1103425348 12:120829451-120829473 CCCGGCATGATGGTATATACCTG 0: 2
1: 25
2: 493
3: 5887
4: 39351
Right 1103425362 12:120829504-120829526 GGGAATCGCTTGGACCTAGGGGG 0: 1
1: 44
2: 2827
3: 57304
4: 165041
1103425354_1103425362 2 Left 1103425354 12:120829479-120829501 CCAGCTACTCTGGAGACTGAGGC 0: 258
1: 14573
2: 206380
3: 260943
4: 175837
Right 1103425362 12:120829504-120829526 GGGAATCGCTTGGACCTAGGGGG 0: 1
1: 44
2: 2827
3: 57304
4: 165041
1103425352_1103425362 3 Left 1103425352 12:120829478-120829500 CCCAGCTACTCTGGAGACTGAGG 0: 337
1: 16942
2: 226070
3: 279138
4: 169904
Right 1103425362 12:120829504-120829526 GGGAATCGCTTGGACCTAGGGGG 0: 1
1: 44
2: 2827
3: 57304
4: 165041

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103425362 Original CRISPR GGGAATCGCTTGGACCTAGG GGG Intronic
Too many off-targets to display for this crispr