ID: 1103425740

View in Genome Browser
Species Human (GRCh38)
Location 12:120831819-120831841
Sequence CTTTGGTGGTAGTGGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103425740_1103425749 20 Left 1103425740 12:120831819-120831841 CCCTCACACCACTACCACCAAAG 0: 1
1: 1
2: 3
3: 30
4: 306
Right 1103425749 12:120831862-120831884 TGAAAGCCTTTTGTTCTAAAGGG 0: 1
1: 0
2: 4
3: 38
4: 333
1103425740_1103425748 19 Left 1103425740 12:120831819-120831841 CCCTCACACCACTACCACCAAAG 0: 1
1: 1
2: 3
3: 30
4: 306
Right 1103425748 12:120831861-120831883 CTGAAAGCCTTTTGTTCTAAAGG 0: 1
1: 2
2: 3
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103425740 Original CRISPR CTTTGGTGGTAGTGGTGTGA GGG (reversed) Intronic
900334605 1:2155746-2155768 GTATGGTGACAGTGGTGTGACGG + Intronic
900505053 1:3025802-3025824 CTATGGTGGTAGGAATGTGATGG + Intergenic
901183132 1:7355517-7355539 TTTTGGGGGTAGGGGTGTAAGGG - Intronic
901557667 1:10044454-10044476 CATGGGTGGTGGTGGTGGGAGGG + Intronic
902682378 1:18052464-18052486 CTTTGGTGGTAGTATTTTGAGGG - Intergenic
903618247 1:24678417-24678439 CTTAGGAGGTTGTGGTGGGAGGG - Intergenic
904922895 1:34022632-34022654 GTTGGGTGGTAGTGGTGAGGTGG + Intronic
905100460 1:35516898-35516920 CTTGGGTGGTGTTGGTGTGTAGG - Intronic
906678128 1:47708126-47708148 CTTTGGGAGTAGGGGTGTGTCGG - Intergenic
907078382 1:51598446-51598468 GTGTGGTGGTAGTGGGGTGGGGG + Intronic
907900937 1:58740966-58740988 CTTTGGTGGTGGTGGTGGTTGGG + Intergenic
908145801 1:61241659-61241681 TTTGGGTGGTAGTTGTGTGGGGG - Intronic
908418371 1:63935146-63935168 CTTTGGTGGTGGTGTTGGCAGGG - Intronic
910056727 1:83041969-83041991 CTTTGGTAGTAATTGTCTGAAGG - Intergenic
910186732 1:84549518-84549540 ATTTGGTGGTGGTGGCGGGAGGG + Intergenic
911334297 1:96562526-96562548 CTTTGGGGGAAGTGGTGGGAAGG - Intergenic
911651961 1:100398943-100398965 TTCTGGTGGTAGGGGAGTGAAGG + Intronic
911781567 1:101886190-101886212 CTTGGGTGGTTGTGGGGAGAGGG - Intronic
911993100 1:104727560-104727582 CTTTGTTGGTGGTGGTGGTAGGG - Intergenic
912457207 1:109806186-109806208 CTTTGGGGGTAGGGGTGTGAGGG - Intergenic
912673604 1:111654924-111654946 CTTTGGAGGTTGAGGTGGGAGGG + Intronic
913147190 1:116003576-116003598 CTGTGTTGCTTGTGGTGTGAAGG + Intronic
913412949 1:118573370-118573392 CTTTGATGATAGTGATGTGCAGG + Intergenic
914915377 1:151816121-151816143 CTGTGGTGGTGGAGGTGTGCAGG + Intronic
915854644 1:159368672-159368694 GTTTGGAGGTTGTGATGTGAAGG - Intergenic
916147044 1:161749585-161749607 CTTTGGGGGTAGGGGTCAGAGGG + Intergenic
916476490 1:165174393-165174415 CATTAGTGCTAGTGGTGTGCTGG - Intergenic
916573127 1:166044556-166044578 GTTGGGTGGGAGTGGGGTGAGGG + Intergenic
916884606 1:169054817-169054839 GTTTGGTGGGGGTGGTGGGAAGG + Intergenic
917990989 1:180378750-180378772 CTATGGTGGCAGTGGTGGGCTGG - Intronic
918114528 1:181484903-181484925 CTCTGATGGTGGTGGTGTCAGGG + Intronic
918490281 1:185074334-185074356 CTTTAGTGGTAGGGGTAGGATGG + Intronic
918617316 1:186560319-186560341 ATTTGGTGGTGGTGGTGTTATGG + Intergenic
921055133 1:211537667-211537689 CTCTGGAGGTACTGGTGTGGGGG - Intergenic
921524753 1:216202836-216202858 CTGTGGTGGCAATGATGTGATGG - Intronic
923424450 1:233854857-233854879 CTTTGGTGCTGGTCTTGTGATGG + Intergenic
1067028459 10:42864624-42864646 CAGTGGTGGTAGTTGTGTGGTGG + Intergenic
1067296311 10:44976989-44977011 AACTGGTGGTAGGGGTGTGAGGG - Exonic
1067320405 10:45214900-45214922 ATTTGGTGGTGGTGGTGTTTTGG - Intergenic
1067372567 10:45699166-45699188 CTTTGATGGTAGATGTCTGAAGG - Intergenic
1067387212 10:45826958-45826980 CTTTGATGGTAGATGTCTGAAGG + Exonic
1067418917 10:46130293-46130315 CTTTGATGGTAGATGTCTGAAGG - Intergenic
1067504269 10:46836882-46836904 CTTTGATGGTAGATGTCTGAAGG - Intergenic
1067876051 10:50009121-50009143 CTTTGATGGTAGATGTCTGAAGG - Exonic
1068291251 10:55004134-55004156 CTTTGGTGGAAGTGGGGGAATGG + Intronic
1069146647 10:64900789-64900811 TTTTGGTGGTAGTGGGGTTTTGG - Intergenic
1069942981 10:71967825-71967847 TTTTGGTGGGAGTGGTGGGATGG + Intronic
1070271016 10:74955024-74955046 CAGTGGTGGTAGAGGGGTGAGGG - Intronic
1072757775 10:98031567-98031589 CCTTGGTGGTGGTGGGGGGATGG + Intergenic
1073638938 10:105230047-105230069 CTCTGGTGGTAGTGGTAGGATGG + Intronic
1074385595 10:113014357-113014379 GTTTGGTGGTAGTTTTGCGAGGG + Intronic
1074432873 10:113408651-113408673 GTTTGGGGGCAGTGGTGGGAAGG - Intergenic
1075533897 10:123254530-123254552 CAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533918 10:123254667-123254689 TGGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533940 10:123254790-123254812 CAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533962 10:123254904-123254926 TAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533980 10:123255017-123255039 TGATGGTGGTGGTGGTGTGATGG - Intergenic
1075534082 10:123255592-123255614 TGGTGGTGGTGGTGGTGTGATGG - Intergenic
1075563509 10:123486111-123486133 CTTTGGGGGTTGTGGTGAGCTGG + Intergenic
1076214195 10:128679725-128679747 CTGGGGTAGCAGTGGTGTGAAGG + Intergenic
1076617458 10:131765394-131765416 CTTTGGTGGTTCTCTTGTGAGGG - Intergenic
1076720856 10:132392240-132392262 GGATGGTGGTGGTGGTGTGATGG + Intergenic
1077117415 11:891406-891428 CTTTGGTTGCTGTGGGGTGAGGG + Intronic
1077816932 11:5694785-5694807 TGTTGGTGGTGGTGGTGTGTGGG + Intronic
1077863181 11:6200798-6200820 CTTTGGTGGGAGTTGGGGGAAGG - Intergenic
1078933651 11:15933771-15933793 CTCTGGTGGTGGTGGTGGGGTGG - Intergenic
1078943029 11:16030779-16030801 CTTTGTGGGTGGTGGTGAGAAGG - Intronic
1079611300 11:22435848-22435870 CCCTGGAGGTAGTGGTGTGCTGG - Intergenic
1081199978 11:40204028-40204050 CTTGGGAGGTTGAGGTGTGATGG - Intronic
1082277285 11:50235546-50235568 TTTTGGTGGTAGTGGGGGGGGGG + Intergenic
1083386387 11:62313314-62313336 CTTCGGTGGCAGTGGTTTCAAGG + Intergenic
1083750997 11:64760481-64760503 CTTCGGTGGGGGTGGAGTGAGGG - Intergenic
1084342952 11:68520460-68520482 CTATGGTGGTTTTGCTGTGAGGG + Intronic
1085208453 11:74751331-74751353 ATTTTGTGGATGTGGTGTGATGG + Intronic
1085933426 11:81114165-81114187 CTTAGGTGGTGGTAGTGGGAAGG - Intergenic
1086807161 11:91258106-91258128 TTTTGGTGGGAGTGCTGTAAGGG + Intergenic
1086932221 11:92705541-92705563 GTGTGATGGTGGTGGTGTGATGG + Intronic
1086932235 11:92705605-92705627 ATGTGGTGGTGGTGGTGTGATGG + Intronic
1086932254 11:92705709-92705731 TGGTGGTGGTGGTGGTGTGATGG + Intronic
1086932288 11:92705873-92705895 TGGTGGTGGTGGTGGTGTGATGG + Intronic
1086932297 11:92705913-92705935 GTTTGATGGTGGTGGTGTGATGG + Intronic
1088378500 11:109168039-109168061 CAATGCTGGTAGTGCTGTGATGG + Intergenic
1089272459 11:117311466-117311488 ATTTGGTGACATTGGTGTGAAGG - Intronic
1090087809 11:123666219-123666241 CTTGGGTGGCTGGGGTGTGAGGG + Intergenic
1090222953 11:125046448-125046470 TTTGGGTGGTAGGAGTGTGAGGG + Intergenic
1091314433 11:134602450-134602472 TTTTGGTGGTAGTGGTTACATGG + Intergenic
1091333568 11:134750106-134750128 TGTTGGTGGTGGTGGTGTTATGG + Intergenic
1093512365 12:19944574-19944596 TGTTGGTGGTAGTGGGGTGTTGG + Intergenic
1094603103 12:31927471-31927493 CTTGGGAGGTTGTGGTGGGAGGG - Intergenic
1095193303 12:39283877-39283899 CTCTGGTGGTAATGGATTGAAGG - Intergenic
1097170745 12:57111237-57111259 TTTTGGTGGTGGTGGTGGAAGGG - Exonic
1098354064 12:69593540-69593562 CTTTGGTGCTGCTGGTGTCATGG + Exonic
1098395401 12:70011482-70011504 CATTGGTGGTAGTGAGGTGGTGG + Intergenic
1099540037 12:83896295-83896317 ATTTGGTGGGAGTGGAGGGAGGG + Intergenic
1100077096 12:90798740-90798762 CTCTGGAGGTGGTGGTGTGAGGG - Intergenic
1100721721 12:97366055-97366077 TTTTGGTGGTCGTGGTGTGGTGG + Intergenic
1101063319 12:100994123-100994145 CCCTGGTGGTAGTGGTGGGATGG + Intronic
1102763452 12:115409971-115409993 GTATGGTGGTAGTGGTGGAAAGG + Intergenic
1103425740 12:120831819-120831841 CTTTGGTGGTAGTGGTGTGAGGG - Intronic
1106297492 13:28429886-28429908 CTTGGGTGGTGGAGGTGAGAAGG - Intronic
1106385047 13:29276501-29276523 CTTTGGGGAAAATGGTGTGATGG + Intronic
1107611784 13:42121665-42121687 CTATGGGTGTAGTGGTGAGAAGG - Intronic
1107797828 13:44072027-44072049 CTTTTGTGTTATTGCTGTGATGG - Intergenic
1108530912 13:51326177-51326199 CTCTGGTGGCAGTGGGGTGGTGG - Intergenic
1109219532 13:59627298-59627320 ATTTGGTGGTAGGGGTGGGGTGG + Intergenic
1109760903 13:66827513-66827535 CGTGGGTGGTGGTGGTGTGGTGG + Intronic
1110815789 13:79858757-79858779 TTTTGGTGGTGGTGGGGTGGGGG - Intergenic
1111558572 13:89913269-89913291 CTTTGGTGGAAGTGGGGGGCTGG + Intergenic
1112239445 13:97666626-97666648 CTATGTTGGCTGTGGTGTGATGG - Intergenic
1114709921 14:24767845-24767867 CTTTGGGGTTAGTCTTGTGAAGG + Intergenic
1115111789 14:29832198-29832220 TTTTGGTGGTGGTGGTGGGGTGG - Intronic
1117783414 14:59257977-59257999 CAATGGTGGTAGTGGTGGGAGGG - Intronic
1119742512 14:77023459-77023481 CTTTGATGGGAGTGGAGTGGGGG + Intergenic
1122096343 14:99375758-99375780 CATTTTTGTTAGTGGTGTGAAGG - Intergenic
1122154208 14:99740642-99740664 CTTTGCTGGCCGTGGTGTGTGGG - Intronic
1122959679 14:105088624-105088646 CTCTGGTGGTTGTGGAGTGAGGG - Intergenic
1125898303 15:43321308-43321330 CTGTGGTGGTAATGATGTGTCGG + Intergenic
1126144236 15:45461973-45461995 TGGTGGTGGTGGTGGTGTGATGG - Intergenic
1126319609 15:47407916-47407938 CCTTGGTGGTGGTGGTGGGGTGG + Intronic
1126856920 15:52847675-52847697 CTGTGGTGGTGGTGGTGGGGTGG + Intergenic
1127822523 15:62671734-62671756 GTTTGGTAGTAGTGGTGAAAAGG - Intronic
1128011298 15:64299092-64299114 CTTTGGGGGGAGTGGTGGGAGGG - Intronic
1128288788 15:66460904-66460926 CTGGGGTGGTTGTGGTGGGAAGG + Intronic
1128932237 15:71715867-71715889 GTTTGGTGGTTGTGGAGTGGTGG - Intronic
1128938326 15:71767451-71767473 TTTTGGTGATAGTGTTGTGCTGG + Intronic
1129780946 15:78270640-78270662 CTTTGGTGGTGGTGGACGGATGG + Exonic
1131757058 15:95576173-95576195 CATTTGTGGTTATGGTGTGAAGG - Intergenic
1132727467 16:1345226-1345248 CTGTGGTGGGAGGGTTGTGAGGG - Intronic
1133229504 16:4359927-4359949 TTTTGGGGGTAGTGGGGAGATGG - Intronic
1133368693 16:5231578-5231600 CTCTGGTGGAGGTGGTGGGAAGG - Intergenic
1133768486 16:8854347-8854369 CTGGGGTGGTGGTGGTGGGAAGG - Exonic
1134418245 16:14062896-14062918 CTTTGGGGGTAGTGGTTGCAGGG - Intergenic
1137017302 16:35391017-35391039 CGTTGGTGGTAGTGGTCCTACGG - Intergenic
1137800656 16:51259370-51259392 TTTGGGTGGTAGTGGTGATATGG + Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1139285183 16:65806458-65806480 CTTTGGGTGTGGTGCTGTGAAGG - Intergenic
1140941209 16:79723178-79723200 CTGTTGAGGTAGTGGTGTGGTGG + Intergenic
1141750749 16:85956335-85956357 CTGTGGTTGTAGTGGAGTGGGGG - Intergenic
1141816408 16:86412599-86412621 CTTTGGTGGTAGGATTCTGAGGG + Intergenic
1142476749 17:193460-193482 CTGTGGTGGGAGTGGGGAGATGG - Intergenic
1142546578 17:708162-708184 CATTGGTGGTAGTGGTGCCCCGG - Intronic
1142896238 17:2980910-2980932 CTTTGGTGGCAGTTGTGGGCTGG + Intronic
1144385109 17:14742040-14742062 CTTTGGTGGTGGTGGTGGGAGGG + Intergenic
1145221248 17:21091139-21091161 CTCTGGTGATAGTGTTGTCATGG - Intergenic
1148550537 17:48547860-48547882 ATTTGGTGGTAGTGATGTTGGGG - Intergenic
1148593785 17:48836570-48836592 CAATGGTGATAGTGTTGTGAAGG + Intronic
1150251001 17:63704401-63704423 GTTCGGTGGTAGGGGTGGGAGGG + Exonic
1150269139 17:63851221-63851243 CTATGGGGATAGTGGGGTGAGGG + Intergenic
1150505833 17:65698120-65698142 CTTTTGTGATACTGATGTGAAGG + Intronic
1150596254 17:66608260-66608282 CTTTGTTGGTGGTGGAGTGGAGG + Intronic
1152664522 17:81559547-81559569 CTGTGGTGGGAGTGCTGTGTGGG - Intronic
1152841958 17:82575427-82575449 TTTAGGTGTTAGTGCTGTGAAGG - Intronic
1153387141 18:4510805-4510827 GTGTGGTGGTGGTGGTGTGGTGG + Intergenic
1153712657 18:7815396-7815418 CTTTGGGGGCAGTTCTGTGAAGG + Intronic
1154238800 18:12632348-12632370 ATTTGGTGGTGGTGGTGTGAGGG - Intronic
1156384723 18:36594746-36594768 CCTTGTTGGCAGTGATGTGATGG + Intronic
1158776659 18:60590499-60590521 CTGTGGTGGTATTGCTCTGAAGG + Intergenic
1159217407 18:65412458-65412480 CTTGGGTGGAAGTGGGGGGAGGG + Intergenic
1162344500 19:10111473-10111495 CTTTGGTGGGACTGGGGGGAGGG - Intronic
1163134443 19:15299465-15299487 CCTTGGTGGTGGTGGTGGGTAGG + Intronic
1163548218 19:17951564-17951586 CTTGGGTGGCAGAGTTGTGAAGG - Intronic
1164004641 19:21137279-21137301 CTCTGATGTCAGTGGTGTGAAGG + Intergenic
1164705016 19:30313570-30313592 CTTTGGAGGTCATGGGGTGAGGG - Intronic
1167424460 19:49423018-49423040 GTTTGGTGGTAGTGGTGGTGCGG - Intronic
1167596196 19:50429377-50429399 ACTTGGTGGTGGAGGTGTGAGGG + Exonic
1167784616 19:51627189-51627211 CCTTGGTGGTGCTGGTGTCATGG - Exonic
1167836287 19:52074201-52074223 CTATTGTGGTAGTGTTGTGTTGG - Intronic
1167963769 19:53127450-53127472 CTTTGGTGGTACTTTTGTGTGGG - Intronic
1168511301 19:56975608-56975630 ATTAGGTGGCCGTGGTGTGATGG - Intergenic
927867041 2:26595815-26595837 CTTTGCTAGTAGTGATGGGAGGG + Intronic
929763331 2:44824236-44824258 CTGGGGTGGTAGGGGTGTGGTGG + Intergenic
933293937 2:80469069-80469091 TTTGTGTGGTGGTGGTGTGACGG + Intronic
933658720 2:84909326-84909348 GTGTGGTGGTGGAGGTGTGATGG - Intergenic
933658774 2:84909605-84909627 GTGTGGTGGTTGAGGTGTGATGG - Intergenic
934659161 2:96133995-96134017 CATGGGTGGTAGTGGTGTCGTGG - Exonic
936040081 2:109142942-109142964 CATGGGTGGTAGTGGAGTGCCGG + Intronic
937433439 2:121860330-121860352 CTTTGATTGTTGTGGTATGAAGG + Intergenic
938319278 2:130352206-130352228 GTTTGGTGGTAGCGCTGAGAAGG + Intergenic
939031593 2:137082388-137082410 CTTTTGTAGTAGTGCTGAGAGGG + Intronic
939235026 2:139480157-139480179 ATTTGGGGTTAGTGGTATGAAGG + Intergenic
941864650 2:170322168-170322190 CTGGGGTGGGAGTGGGGTGAAGG - Intronic
942147142 2:173038138-173038160 CTTTGGTGTGAGGGGTGGGAAGG - Intronic
944298967 2:198100796-198100818 TTTTGGTGGGAGTGGGGTGGGGG + Intronic
945191835 2:207196797-207196819 CTTTGGTGGTGGTGGGGTAGGGG - Intergenic
947372097 2:229457602-229457624 CTTTGGTGGTGGGGGTGGGTGGG - Intronic
947964205 2:234265714-234265736 CTCTGGGGGAGGTGGTGTGAAGG - Intergenic
948815290 2:240507390-240507412 CCTGGGTGGCAGGGGTGTGAGGG - Intronic
949046680 2:241875396-241875418 CATTGGTGGTAGTGGTCCGCAGG - Intergenic
1169959250 20:11140606-11140628 CTTTGTTGCTTGTGGTTTGAGGG + Intergenic
1172187485 20:33040152-33040174 CAATGGTGGTAGTGCTGGGAGGG + Intronic
1173836496 20:46129294-46129316 GTTTGGTGGTGGTGGTGTTGGGG + Exonic
1174391365 20:50220213-50220235 CTTGGGTGGTGGAGGTGAGAAGG + Intergenic
1175093249 20:56521948-56521970 GTTTGGTGGCTGTGGTGCGATGG - Intronic
1175420684 20:58830568-58830590 TTGTGGTGGTGGTGGTGTGGTGG - Intergenic
1175480202 20:59305239-59305261 TTTTGTTGGCAGTGGTGGGATGG - Intronic
1180830742 22:18904762-18904784 CTTTGGTGGTAGTGGTCCCCCGG - Intergenic
1183199093 22:36373496-36373518 CTTTGTCAGTAGTGGTGAGAAGG - Intronic
1203280831 22_KI270734v1_random:130033-130055 CTTTGGTGGTAGTGGTCCCCCGG - Intergenic
950047671 3:9959637-9959659 CTTTGTAGGGACTGGTGTGAAGG - Intergenic
950330796 3:12154553-12154575 CTTTGGTGGCAGTGGTGGCATGG + Intronic
951098361 3:18657860-18657882 ATTTGGTGGTAGTGGTGCAGAGG + Intergenic
952307396 3:32158364-32158386 CTTTGGTGGTGGAGGTGGGCTGG + Intronic
952820132 3:37479472-37479494 CCTTGGTGGCAGTGGCTTGAAGG + Intronic
954003484 3:47575839-47575861 TTCTGGTGGTACTGGTGAGAGGG - Intronic
954982889 3:54761972-54761994 CTCTGGAGCTAGTGCTGTGATGG + Intronic
955708806 3:61756874-61756896 CTCTGAAGGTAGTGGGGTGATGG + Intronic
955800051 3:62677260-62677282 TTTTGGTGCTAGTGGTGAGGAGG - Intronic
958428242 3:94005329-94005351 CTATGGTGGTAGTGATGACAAGG + Intronic
959453256 3:106528733-106528755 CTTTGGGGGTTGGGGGGTGAGGG + Intergenic
961281805 3:125770190-125770212 CATTCGTGGTGGTGGTGGGAGGG + Intergenic
961486811 3:127222492-127222514 CTCTGGTTGCAGTGGGGTGAGGG + Intergenic
961620089 3:128217271-128217293 CTGTGGTGGTAGTGGTGGGGAGG + Intronic
961917636 3:130393591-130393613 TTTTTGAGGTAGTGGTGAGATGG + Intronic
962706756 3:138051301-138051323 TGATGGTGGTAGTGGAGTGATGG + Intergenic
962873130 3:139515486-139515508 CATTGGGGGTGGAGGTGTGATGG + Intergenic
964101459 3:152992778-152992800 CGTTGGTGGTAGTGGTCTCCCGG + Intergenic
965644034 3:170860950-170860972 CATTGGTGGTAGTGGTCTCCCGG + Intergenic
965740767 3:171872033-171872055 AATTGGTGGTAGTGGTGACAGGG - Intronic
967718914 3:192794568-192794590 CTTTGCTGGTAATGCTGGGAAGG - Intergenic
968280151 3:197471092-197471114 ATTTGGAGCTAGGGGTGTGAAGG - Intergenic
969446129 4:7245650-7245672 TATTGGTGGTGGTGGTGTTATGG + Intronic
969569119 4:7998218-7998240 CTTCGGTGTTCTTGGTGTGACGG + Intronic
970511764 4:16788314-16788336 CTTTGGGGGTGGTGATGGGAAGG + Intronic
970808483 4:20063576-20063598 GTTAGGTGTAAGTGGTGTGAAGG - Intergenic
971073751 4:23124978-23125000 CTTTGATGGTGTGGGTGTGAAGG + Intergenic
973818460 4:54640747-54640769 TTTAAGTGGAAGTGGTGTGAAGG - Intergenic
974765609 4:66341736-66341758 ATTTGCTGGTAGTAGTGGGATGG - Intergenic
975302568 4:72807836-72807858 CTTTGGTGGTGGTCGTGGGGTGG + Intergenic
975320247 4:73002097-73002119 ATTTGGAGGCAGTGGTGAGAAGG - Intergenic
975340424 4:73233616-73233638 ATATGGTGGTAGTGGGGGGATGG - Intronic
978185119 4:105848525-105848547 TTTTGGTGGTGGTGGTGGGGGGG - Intronic
978224033 4:106312991-106313013 TTGTGGTGGTAGTGGTTTTATGG + Intronic
978461540 4:108959491-108959513 CTTTGGTTGTAGTGGGGAAAAGG - Intronic
978487915 4:109276914-109276936 GGTTGGTGGTAGTGATGTTAAGG - Intronic
978852225 4:113352929-113352951 CTGTGGTGGTGGTGGTGGGAGGG - Intronic
979449687 4:120855659-120855681 TTTTGGTGCTATTGCTGTGAGGG - Intronic
979472954 4:121122989-121123011 CTTTGGAGGTTATGGTGAGATGG + Intergenic
980716223 4:136633216-136633238 CTTTGATAGAAGTGGTGAGAAGG + Intergenic
980941397 4:139278928-139278950 CTCTGTTGGTGGTGGTGGGAGGG - Intronic
981067621 4:140501717-140501739 CTTGTGTGGTAGAGGTGTGCAGG - Intergenic
981533187 4:145772992-145773014 CTATGGTGGTATGGGTGTGGAGG + Intronic
982236564 4:153256277-153256299 CTTTGGTGGTAGTAGGAGGAGGG - Intronic
983567864 4:169173923-169173945 ATTTGGTAGTGGTGGTGTGTGGG - Intronic
985577655 5:681220-681242 CTCTGGGGGAAATGGTGTGAGGG - Intronic
985592581 5:773318-773340 CTCTGGGGGAAATGGTGTGAGGG - Intergenic
988923851 5:35969476-35969498 CTTTGGTGGTGGTGGGTGGATGG - Intronic
992626381 5:78639157-78639179 CAATGGTGGTGGTGGTGGGAAGG - Intronic
992935074 5:81694637-81694659 GTTTGGTGGTGGTGGGGTAAGGG - Intronic
993177566 5:84507723-84507745 GTGGGGTGGTTGTGGTGTGAAGG + Intergenic
993685537 5:90933219-90933241 GTTTGGTGGTAGTGGTGGCAAGG + Intronic
995575584 5:113528912-113528934 TTTTGGTGGTAGTGGTGGTGGGG + Intronic
995596220 5:113751070-113751092 ATTTGGTGGTTGTGGTGGGGTGG + Intergenic
997797029 5:136820661-136820683 ATTTGGTGGTGGTGGTGGAATGG - Intergenic
997822761 5:137080728-137080750 CTTTGGTGATAGTTGTGGCAGGG - Intronic
998199616 5:140108674-140108696 ATTTGGTGGTAGTGGGGTGGGGG - Intronic
998350645 5:141498406-141498428 CTTTGCTGGCACTGGAGTGAGGG + Intronic
1000138816 5:158381513-158381535 CTTTGCTGGAACTAGTGTGAGGG + Intergenic
1000630746 5:163587803-163587825 GTTTTCTGGTGGTGGTGTGAGGG - Intergenic
1000981669 5:167823440-167823462 ATTTGGTGGCAGGGGGGTGAGGG - Intronic
1001667069 5:173442042-173442064 CTGTGGTGGTGGTGGTGTTATGG - Intergenic
1001684377 5:173582478-173582500 GTTTGGTGGCATTGGGGTGAGGG + Intergenic
1001833634 5:174811280-174811302 ATTTGGTGGTGGTGGTCTGGGGG + Intergenic
1003179606 6:3780511-3780533 CTTGGGTGGAAGTCCTGTGAAGG + Intergenic
1003182225 6:3801806-3801828 CCTTGGAGGAAGTGGTGTTAAGG + Intergenic
1007179712 6:39921043-39921065 CTTAGGTGGCAGTGGGGTGGGGG + Intronic
1010281904 6:74031953-74031975 CTTTGGTTCTGGTGATGTGATGG + Intergenic
1010831816 6:80540582-80540604 TTTTGCTTGGAGTGGTGTGATGG + Intergenic
1011701057 6:89955226-89955248 CTTCTGTGCTAGTGGTGTGAGGG + Intronic
1014398035 6:120950887-120950909 GTTTGGTGGTGTTGGTGTGAAGG - Intergenic
1014543137 6:122700294-122700316 ATTTGGTGGTGGTGGGGTGGTGG + Intronic
1015105361 6:129530307-129530329 CTTTGTTGGGAGTGCTGTAAAGG + Intergenic
1015725027 6:136290981-136291003 CTGAGGTGGTAATGGGGTGAGGG - Intergenic
1017345682 6:153377773-153377795 CTTTGGTGGTATTGATGAGAAGG - Intergenic
1017762838 6:157584293-157584315 CTCTGGTGGCTGTGGTGTGCTGG + Intronic
1018883187 6:167905497-167905519 CTTTGATAGTAATGTTGTGAGGG + Intronic
1019734003 7:2641565-2641587 CTGTGGTGGAAGTGATGTAAGGG - Intronic
1024234791 7:47389790-47389812 CTTTGGTGTTTGTGGGTTGAAGG + Intronic
1025756627 7:64350798-64350820 GTTTGGTGGTGGTGGTGGGTGGG + Exonic
1028133063 7:87199688-87199710 CTTTGTTGGTTGGGGTGGGATGG - Intronic
1028472344 7:91219095-91219117 GTTGGGAGGTAGTGGTGTGCTGG - Intergenic
1029196782 7:98810987-98811009 CAGTGGTGGTGGTGGTGTGGTGG + Intergenic
1029562108 7:101309330-101309352 CATTGGTGGTAGTGGTGCCCCGG - Intergenic
1030681748 7:112441346-112441368 CTTTGGAGGCTGTGGTGGGAGGG + Intronic
1031075545 7:117208868-117208890 CTTTGGTGGTGGTGGTGGGGTGG + Intronic
1031484245 7:122309317-122309339 CTTTGGGGGAAGAAGTGTGAGGG + Intronic
1031553877 7:123147877-123147899 CTTTGGGAGTAGTGGTGAGAAGG - Intronic
1033086516 7:138347220-138347242 ATTTTGTGGTAGTGGTGGTAAGG - Intergenic
1033185326 7:139222492-139222514 CTGTGGTGGTGGTGGGGTGGGGG + Intergenic
1034018213 7:147609982-147610004 TGGTGGTGGTACTGGTGTGAAGG + Intronic
1034054442 7:148019771-148019793 TTTTGGGGGGAGGGGTGTGAGGG + Intronic
1034883274 7:154778633-154778655 TTGTGGTGGTGGTGGTGTGGTGG - Intronic
1037594053 8:20339375-20339397 TTGTGGTGGTGATGGTGTGAAGG + Intergenic
1037602322 8:20407561-20407583 ATTTGGTGGCGGTGGTGGGAGGG + Intergenic
1037693982 8:21207872-21207894 CGGTGGTGGTAGTGCTGGGAGGG - Intergenic
1037759026 8:21729752-21729774 CTTTGGGGGTGGCGGTGGGAGGG - Intronic
1037924049 8:22830782-22830804 ATGTGGTGGTAGTGGTGATAGGG - Intronic
1038234875 8:25743041-25743063 ATTTGGTGGTAGGGTTGGGAAGG - Intergenic
1040430613 8:47338149-47338171 CTTTCCTGGTGGTGGTGTGTGGG + Intronic
1041415499 8:57603436-57603458 AATTGGTGGTAGTTGTGTGTTGG - Intergenic
1041852367 8:62405626-62405648 GCTGGGTGGTAGTGGTGTGGGGG + Intronic
1043050897 8:75384292-75384314 TTTTGGTGGTGGTGGGGTGGGGG - Intergenic
1045309228 8:100986036-100986058 ATTTGGTGGTGGTGGGGCGATGG - Intergenic
1045403189 8:101839200-101839222 CTGTGATGGTAGTGGTGTGCAGG + Intronic
1046544150 8:115626628-115626650 ATTTGGTGGAAGTTGTTTGAAGG - Intronic
1046787143 8:118280061-118280083 TTTTGGTGGTGGTGATGTGTAGG + Intronic
1049139232 8:140936641-140936663 ATTTGCTGGTGGAGGTGTGAAGG - Intronic
1049783124 8:144438008-144438030 CTTTGGAGGTTGAGGTGGGAGGG - Intronic
1049952380 9:657877-657899 TCTTGGTGGTGGTGGTGTGGGGG + Intronic
1052244650 9:26320036-26320058 CTTGGGTGGCTGTGGTGGGAGGG - Intergenic
1053252422 9:36585828-36585850 CTTGGGAGGTGGTGGTGGGAGGG + Intronic
1053510030 9:38679861-38679883 ACTTGGTGGCAGTGATGTGATGG - Intergenic
1057466200 9:95317016-95317038 GTTTGGGGGCAGGGGTGTGAGGG + Intronic
1057617848 9:96607847-96607869 CTGTGGTGGCAGTTGTGTGGTGG - Intronic
1058041947 9:100312286-100312308 ATTTGGTGGGAGTGCTGAGATGG + Intronic
1058562532 9:106245190-106245212 CTATTGTGGTAGTTGTGTGAAGG - Intergenic
1059522523 9:114956986-114957008 CTTTTCTGGTTGTGGTATGAAGG + Intergenic
1059718513 9:116936090-116936112 TTTTAGTGGTAGTGGTGTGGTGG - Intronic
1059768076 9:117402783-117402805 GGGTGGTGGTGGTGGTGTGATGG + Intronic
1059866778 9:118523086-118523108 CCTTGGAGGGAGTGGTATGATGG - Intergenic
1059918916 9:119135931-119135953 TTTTGATGGTAGTATTGTGATGG - Intergenic
1059918919 9:119135989-119136011 TTTTGATGGTAGTGTTTTGATGG - Intergenic
1061844992 9:133382641-133382663 TGATGGTGGTGGTGGTGTGATGG + Intronic
1061845041 9:133382982-133383004 TGATGGTGGTCGTGGTGTGATGG + Intronic
1062679856 9:137773306-137773328 ATTTGGTGGTGGTGGTGTGGAGG + Intronic
1185746752 X:2579558-2579580 ATTTGGTGGCAGTGATGAGAGGG - Intergenic
1186553330 X:10530334-10530356 CTTTGGTGGTAGTGGTGGGAGGG - Intronic
1189897824 X:45673745-45673767 CAGTGGTGGTGGTGGTGTGTTGG - Intergenic
1190334443 X:49253805-49253827 CAGTGGTGGTGGTGGTGGGAAGG + Intronic
1190530031 X:51365495-51365517 CTTTGGTTCTATTTGTGTGATGG - Intergenic
1191852288 X:65594393-65594415 CAATGGTGGTAGTGGCATGAGGG + Intronic
1192270796 X:69577534-69577556 CTTTGGTTGTGGTGGTATGTTGG + Intergenic
1192631587 X:72781784-72781806 CTTTGGTGGTGGTGGGGTTGTGG - Intronic
1192650122 X:72939017-72939039 CTTTGGTGGTGGTGGGGTTGTGG + Intronic
1194008551 X:88529466-88529488 CTTTGGTGGAAGTTGGGGGATGG - Intergenic
1195545183 X:106105963-106105985 CTCTGGGGGCAGTGATGTGAGGG - Intergenic
1196222432 X:113126810-113126832 CTCTAGTGGAAGTGGTGGGAAGG - Intergenic
1197082901 X:122440586-122440608 CTGTGGTGGTACTGGTTTGCAGG + Intergenic
1198395566 X:136215624-136215646 CTTTGGTGGGGATGGTGTGGTGG - Intronic
1198743926 X:139870124-139870146 CTTTAGTTGTAGTGGTTTCATGG + Intronic
1198942976 X:141978707-141978729 CTTTGCTGGTTTTGGTGTTAGGG + Intergenic
1199879359 X:151960928-151960950 TTTTGGTGGTAGAGGTTTGGAGG + Intronic