ID: 1103430572

View in Genome Browser
Species Human (GRCh38)
Location 12:120881746-120881768
Sequence CGCTAAATATAGATGAAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103430568_1103430572 28 Left 1103430568 12:120881695-120881717 CCATACAGTCAAGTATTATCCAG 0: 1
1: 0
2: 7
3: 63
4: 534
Right 1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 79
1103430570_1103430572 9 Left 1103430570 12:120881714-120881736 CCAGCCTTTAAAAGGAAGAAAAT 0: 3
1: 5
2: 57
3: 166
4: 1025
Right 1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 79
1103430567_1103430572 29 Left 1103430567 12:120881694-120881716 CCCATACAGTCAAGTATTATCCA 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 79
1103430571_1103430572 5 Left 1103430571 12:120881718-120881740 CCTTTAAAAGGAAGAAAATTCTG 0: 7
1: 153
2: 796
3: 2013
4: 4293
Right 1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103430572 Original CRISPR CGCTAAATATAGATGAAGCT CGG Intronic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
909561910 1:77016584-77016606 TGCTAATTAGAGATGGAGCTGGG + Intronic
911215339 1:95187192-95187214 CGCTAACAATAGGGGAAGCTGGG - Intronic
911848691 1:102786557-102786579 AGATAAATAAAGAAGAAGCTGGG - Intergenic
913326450 1:117632465-117632487 CACTAAATATAGTGGAAGTTGGG + Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
1070897623 10:79998398-79998420 TGGAAAATATAGATGAGGCTGGG - Intergenic
1071808686 10:89153490-89153512 GGCTAAATAGAAAAGAAGCTGGG - Intergenic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1083337003 11:61928371-61928393 CCCTCAAAATACATGAAGCTAGG + Intergenic
1083337020 11:61928491-61928513 CCCTCAAAATACATGAAGCTAGG + Intergenic
1084042964 11:66553256-66553278 CCCAAAAAATAGATGCAGCTGGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1087849019 11:103006916-103006938 GGCTAAATATACATGATGCTTGG - Intergenic
1091724747 12:2838031-2838053 AGCTAAGTCTAAATGAAGCTCGG - Intronic
1091976404 12:4829438-4829460 CGCTAAATATAGAGGTTGCCAGG + Intronic
1093316253 12:17654834-17654856 CATTAAACATAGATGAAGCCAGG + Intergenic
1093965567 12:25321163-25321185 CGCTATATGTATTTGAAGCTTGG + Intergenic
1094007165 12:25767209-25767231 CACACAATATAGATGAAGCTCGG - Intergenic
1103430572 12:120881746-120881768 CGCTAAATATAGATGAAGCTCGG + Intronic
1105852452 13:24348035-24348057 CGTTAAATAAAAAGGAAGCTGGG + Intergenic
1114997302 14:28371633-28371655 CGCTTAATATAAAACAAGCTAGG + Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1122732950 14:103815124-103815146 TGCTAAACATGGATGAAGCTTGG + Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1131364437 15:91826630-91826652 AGCCAAATATAAATGAAGCCAGG + Intergenic
1132390967 15:101437820-101437842 CCCTAACAATAGGTGAAGCTGGG - Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1145090216 17:19979955-19979977 CGCTAACTAGGGATGAAGCCTGG + Intergenic
1146077634 17:29746248-29746270 CCCTAAAAATAGATGAGGCCAGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1151871921 17:76842205-76842227 CTCTAATTATAGCTGAGGCTTGG + Intergenic
1154203549 18:12317954-12317976 CTATAAATATTGAGGAAGCTGGG + Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1158554496 18:58464222-58464244 TGCTAAATCTAGTTGAAGTTGGG - Intergenic
1158578751 18:58662863-58662885 CCAAAAATATAGAAGAAGCTGGG + Intergenic
1165654569 19:37521828-37521850 GGCTTTATATAGATGAATCTAGG - Intronic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933311430 2:80666094-80666116 CCCTCAATGAAGATGAAGCTGGG - Intergenic
940118985 2:150241791-150241813 GGCTAAGTATAGATGAAGAAAGG - Intergenic
943474697 2:188340200-188340222 AGTTAAATATAGATGATGTTAGG + Intronic
947459869 2:230294489-230294511 CACTAAATGTATATAAAGCTAGG + Intronic
1172656099 20:36539431-36539453 CACTAAACATGGATGAACCTGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
955157638 3:56432897-56432919 CACCAATTAGAGATGAAGCTGGG + Intronic
970811350 4:20098224-20098246 AGAAAAATATAGATAAAGCTAGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
972120125 4:35691495-35691517 CTCTAAAAGTAGATAAAGCTAGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975930528 4:79516856-79516878 AGATAAATATAGATGTAGATGGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978021326 4:103816938-103816960 TGGTAAATATAGTTTAAGCTTGG - Intergenic
979006354 4:115302895-115302917 TGCTAAATATTAATGAAGCATGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983076499 4:163332586-163332608 TCCTAAAGATTGATGAAGCTAGG + Exonic
983487551 4:168350137-168350159 TCCTAAATATAGATGCACCTGGG - Intergenic
984545964 4:181102934-181102956 CGCTTTATACACATGAAGCTAGG + Intergenic
986363750 5:7008437-7008459 AGCAAAATAAAGATGAAGTTAGG + Intergenic
988166121 5:27591119-27591141 AGCTGAATAGAGAGGAAGCTGGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
994490343 5:100434928-100434950 CTCTAAATAGAGATGGGGCTGGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995931279 5:117448927-117448949 TGAGAAAAATAGATGAAGCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1007248567 6:40480204-40480226 GGCTAGATATTGATGAAGCTGGG + Intronic
1008005771 6:46407249-46407271 AGCTAAATTTAGATGAAACCAGG + Intronic
1009731334 6:67611556-67611578 TGCTAAAAATAAATGAAGATAGG - Intergenic
1012858317 6:104528760-104528782 TCCTAGATAAAGATGAAGCTAGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1031518521 7:122733149-122733171 TGCTAGATATATATGAAGCATGG - Intronic
1032260365 7:130331195-130331217 GGCTAAATAAAGATGAGGATAGG - Intergenic
1034306867 7:150050179-150050201 CACTAAATATAGATGCAGTTAGG + Intergenic
1034799978 7:154050465-154050487 CACTAAATATAGATGCAGTTAGG - Intronic
1037077162 8:14734685-14734707 CACTTAATGTAGAGGAAGCTTGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1046739881 8:117816581-117816603 GCCTGAATATAGATGCAGCTGGG + Intronic
1047661653 8:127043809-127043831 TGCTAAATAGAGTTCAAGCTGGG - Intergenic
1052320563 9:27163153-27163175 CACTAATAATAGATGAGGCTTGG + Intronic
1053418620 9:37962811-37962833 CACTAAATAAAGAGTAAGCTAGG - Intronic
1055212683 9:73816423-73816445 CACTAAATATAAATGAAGAAAGG - Intergenic
1055897871 9:81200311-81200333 CTCTAAATGTACATAAAGCTGGG + Intergenic
1057296607 9:93848357-93848379 AGCTGAATAGAGAGGAAGCTGGG + Intergenic
1058789501 9:108428348-108428370 TGCTAAAACTAGAGGAAGCTAGG - Intergenic
1059786415 9:117591151-117591173 CTCTAATTATAGCTGGAGCTAGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1194813042 X:98409628-98409650 TGCTAAAAATAGATGAATGTAGG - Intergenic
1194831228 X:98624614-98624636 CTCTAAAAATAGAAGAATCTTGG - Intergenic
1195416426 X:104624887-104624909 CACTAAATATAGATGGCACTTGG + Intronic
1196193900 X:112820698-112820720 AGCAAAATATCAATGAAGCTGGG - Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic