ID: 1103430626

View in Genome Browser
Species Human (GRCh38)
Location 12:120882218-120882240
Sequence TATACAGGGTTCAGTACTAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 3, 2: 4, 3: 9, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103430620_1103430626 30 Left 1103430620 12:120882165-120882187 CCACCAGTTTGACATTTGATAAC 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG 0: 1
1: 3
2: 4
3: 9
4: 63
1103430621_1103430626 27 Left 1103430621 12:120882168-120882190 CCAGTTTGACATTTGATAACCAT 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG 0: 1
1: 3
2: 4
3: 9
4: 63
1103430623_1103430626 8 Left 1103430623 12:120882187-120882209 CCATCTTGGTTATCAGATTGAAT 0: 2
1: 21
2: 59
3: 172
4: 448
Right 1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG 0: 1
1: 3
2: 4
3: 9
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103430626 Original CRISPR TATACAGGGTTCAGTACTAT CGG Intronic
906011439 1:42530866-42530888 TATAGAGGGTTTGGTACCATTGG + Intronic
907516906 1:54998622-54998644 TATCCAGGGTTCAGGAATAATGG - Intergenic
912605910 1:110988156-110988178 TTTTCTGGGTTTAGTACTATTGG - Intergenic
915203687 1:154252972-154252994 TATACAGGATACATTACTCTTGG - Intronic
917295761 1:173517613-173517635 TTTACAGAGTTCTGTACTACTGG - Exonic
917493149 1:175515566-175515588 AATACAGGGTGCATTCCTATAGG + Intronic
919348364 1:196416427-196416449 TATATAGGGTTTGGTACTATCGG + Intronic
1065578711 10:27150265-27150287 TATACCAGGTTTAGTACTACAGG + Intronic
1071209982 10:83329954-83329976 TGTAGAGGGCTTAGTACTATAGG - Intergenic
1079863027 11:25697559-25697581 TATAAAGTGTTCAATACAATAGG + Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1099370564 12:81824856-81824878 TGGACAGGGTTCATTAGTATGGG + Intergenic
1103430626 12:120882218-120882240 TATACAGGGTTCAGTACTATCGG + Intronic
1107700479 13:43042153-43042175 TATGAAGGGACCAGTACTATAGG - Intronic
1107703908 13:43079845-43079867 TATACAGCTTTCAGTTCTATGGG - Intronic
1109473941 13:62852857-62852879 TATATAGGGTTTGGTACTATTGG - Intergenic
1111911568 13:94318336-94318358 TATATAGGGTTTGGTACTATGGG - Intronic
1124446457 15:29738687-29738709 TAAAGAGGTTTCAGTACAATGGG - Intronic
1130557723 15:84934651-84934673 TATACAGGGTTAAGTAAAATCGG - Intronic
1135482921 16:22837445-22837467 TATATAGGGTTTGGTATTATCGG - Intronic
1143147137 17:4783928-4783950 TAAACAGGGATCAGTTCTGTAGG + Intergenic
1145915085 17:28568694-28568716 AACACAGTGTTCAGTAATATGGG - Intronic
1147387635 17:40091467-40091489 AATACAGGATTCAGTACTCCAGG - Intronic
1149175440 17:53865101-53865123 TATGCAGAGTTGAATACTATTGG - Intergenic
1149801138 17:59568490-59568512 TATGCAGGGTTTGGTATTATTGG - Intronic
1151016719 17:70562935-70562957 TATATAGGGTTCAGTACCCACGG - Intergenic
1151248739 17:72817151-72817173 TGTACAGGCTTCAGAACCATTGG - Intronic
1154053281 18:10983853-10983875 TATACAACGTTCAGTACTTCAGG + Intronic
1154284964 18:13046072-13046094 TATACAGCCTGCAGAACTATGGG - Intronic
1154961166 18:21310025-21310047 TATACAGTAGTCATTACTATAGG + Intronic
1155200664 18:23514914-23514936 TGTACAGTGTTCTGTAATATCGG + Intronic
1156371605 18:36476377-36476399 GCTACAGGGTTCAGGACTGTGGG + Intronic
1156887784 18:42155690-42155712 TATTCAGGGTTCAGAACCAATGG - Intergenic
1157482638 18:48065376-48065398 TAAACAGGTTTCTATACTATGGG - Intronic
938391861 2:130913046-130913068 TATATAGGGTTCGGTACTGGGGG + Intronic
943913787 2:193602267-193602289 TATATAGAGTTCAGTACTATTGG - Intergenic
944089039 2:195884043-195884065 TATACAGATTTAAGTACAATTGG - Intronic
946837530 2:223787246-223787268 TATACAGCCTTCAGAACCATGGG + Intronic
1174496803 20:50950976-50950998 TATATAAGGTTTGGTACTATTGG - Intronic
1177814824 21:25964648-25964670 TATACAGGCTGGAGTACAATGGG + Intronic
949093243 3:54690-54712 TACATAGGGTTCTCTACTATTGG + Intergenic
952127420 3:30317419-30317441 TTTACAAAGTTCAGTACTAAAGG + Intergenic
952286142 3:31971464-31971486 TATAAAGGGTTTAGGACAATGGG - Intronic
957033500 3:75270761-75270783 TACATAGGGTTCTGTACTATTGG + Intergenic
958510014 3:95036526-95036548 GATTCAGGGTTCAGGACAATTGG + Intergenic
965410431 3:168323391-168323413 TATATAGGGTTCAGTACTATCGG - Intergenic
969574189 4:8027050-8027072 TATAAAGATGTCAGTACTATGGG + Intronic
972293956 4:37718659-37718681 TATAAAGAGTTCAGTTTTATAGG + Intergenic
979964546 4:127062153-127062175 TATAGAGGGTTTGGTACTATTGG - Intergenic
980221940 4:129929228-129929250 TATACAGGATTCGGTACTACAGG + Intergenic
982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG + Intergenic
989156211 5:38347169-38347191 GATGCAGGGCTCAGTAGTATCGG + Intronic
991132673 5:63142372-63142394 TATAGAGGGTTCAGTACTATTGG - Intergenic
991191361 5:63878103-63878125 TAGCCAGGGTTCAGAACTAAGGG - Intergenic
994101777 5:95901471-95901493 TATATAGGGTTCGTTACCATCGG - Intronic
997676493 5:135716956-135716978 TATACCGGTTTATGTACTATGGG + Intergenic
999942156 5:156554664-156554686 TCTAAATGATTCAGTACTATGGG + Intronic
1000646804 5:163769444-163769466 TGTACAGGGTGCAGAGCTATGGG - Intergenic
1000955047 5:167533348-167533370 TGTACAGGCTTGAGTACAATGGG + Intronic
1003012862 6:2442394-2442416 TATACAGGGCTGAGTACCAAAGG + Intergenic
1004214557 6:13689613-13689635 GATACATGGTTCAGTATTGTTGG - Intronic
1012711822 6:102616753-102616775 TGTACAGGTTCCAGTACAATTGG - Intergenic
1015988216 6:138907755-138907777 TATATAAGCTTCAGCACTATAGG + Intronic
1021409698 7:20316001-20316023 TTTTCAGGCTTCAGAACTATGGG + Intergenic
1021483441 7:21143518-21143540 GCTACAGGGTCCAGTACTCTTGG + Intergenic
1027378619 7:77579943-77579965 TATACAGGGTTATGTAATAAGGG - Intronic
1027792957 7:82656537-82656559 TTTACAGGGTACAGTACTGGCGG + Intergenic
1039026836 8:33267756-33267778 TATACAGGGTTCTGTACCATTGG - Intergenic
1042259762 8:66846271-66846293 TGTACAGGTTTCTGTACTCTGGG - Intronic
1044727042 8:95202434-95202456 TATATAGGGTTCAGTACTCTTGG - Intergenic
1044741694 8:95334268-95334290 TATGCAGGGGTAAGTCCTATAGG - Intergenic
1047322438 8:123800221-123800243 TATATAGGGTTGGGTACTACTGG - Intronic
1051531078 9:18104393-18104415 TATACAGTGCTTAGTACTAAAGG + Intergenic
1055693144 9:78855860-78855882 TATACAGGGTTCATCATGATTGG + Intergenic
1056147025 9:83742258-83742280 GATACAGGGTTAAGTTCTATTGG + Intronic
1058500965 9:105615739-105615761 TATATAGGGTTCAGTACTATCGG - Intronic
1059834139 9:118130834-118130856 TATACAGAGTTAAATGCTATGGG + Intergenic
1193721169 X:84989629-84989651 TATTAAGTGTTCAATACTATAGG + Intergenic
1195996322 X:110735311-110735333 TAAACAGGTTTCTTTACTATGGG - Intronic
1201380330 Y:13368999-13369021 AATACAGGGTTTGGAACTATCGG + Intronic