ID: 1103434605

View in Genome Browser
Species Human (GRCh38)
Location 12:120915151-120915173
Sequence GCTTTTGTGGAGAAAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103434605_1103434617 23 Left 1103434605 12:120915151-120915173 CCCTCCATTTTCTCCACAAAAGC No data
Right 1103434617 12:120915197-120915219 CCAATGGACACACTCCAAAATGG No data
1103434605_1103434613 7 Left 1103434605 12:120915151-120915173 CCCTCCATTTTCTCCACAAAAGC No data
Right 1103434613 12:120915181-120915203 GTTTCCATATTGCAACCCAATGG No data
1103434605_1103434618 30 Left 1103434605 12:120915151-120915173 CCCTCCATTTTCTCCACAAAAGC No data
Right 1103434618 12:120915204-120915226 ACACACTCCAAAATGGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103434605 Original CRISPR GCTTTTGTGGAGAAAATGGA GGG (reversed) Intergenic
No off target data available for this crispr