ID: 1103440583

View in Genome Browser
Species Human (GRCh38)
Location 12:120959893-120959915
Sequence GTCATCACGCATCATAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103440580_1103440583 14 Left 1103440580 12:120959856-120959878 CCTCAGGAGCTTCTCTGGTTAGC No data
Right 1103440583 12:120959893-120959915 GTCATCACGCATCATAGCTGGGG No data
1103440578_1103440583 20 Left 1103440578 12:120959850-120959872 CCAAAGCCTCAGGAGCTTCTCTG No data
Right 1103440583 12:120959893-120959915 GTCATCACGCATCATAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103440583 Original CRISPR GTCATCACGCATCATAGCTG GGG Intergenic
No off target data available for this crispr