ID: 1103441610

View in Genome Browser
Species Human (GRCh38)
Location 12:120967083-120967105
Sequence TTCGGTCGCGGGGCTGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103441610_1103441615 -9 Left 1103441610 12:120967083-120967105 CCTCAGCCAGCCCCGCGACCGAA No data
Right 1103441615 12:120967097-120967119 GCGACCGAAGTACAACGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103441610 Original CRISPR TTCGGTCGCGGGGCTGGCTG AGG (reversed) Intergenic
No off target data available for this crispr