ID: 1103441849

View in Genome Browser
Species Human (GRCh38)
Location 12:120968879-120968901
Sequence TAGGGAAGGCCAGCCAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103441844_1103441849 -2 Left 1103441844 12:120968858-120968880 CCGTAGCTCTGCTCCAGTGAGTA No data
Right 1103441849 12:120968879-120968901 TAGGGAAGGCCAGCCAGTGAAGG No data
1103441841_1103441849 21 Left 1103441841 12:120968835-120968857 CCCTGCTCCAGGGCATTCTGATG No data
Right 1103441849 12:120968879-120968901 TAGGGAAGGCCAGCCAGTGAAGG No data
1103441840_1103441849 22 Left 1103441840 12:120968834-120968856 CCCCTGCTCCAGGGCATTCTGAT No data
Right 1103441849 12:120968879-120968901 TAGGGAAGGCCAGCCAGTGAAGG No data
1103441842_1103441849 20 Left 1103441842 12:120968836-120968858 CCTGCTCCAGGGCATTCTGATGC No data
Right 1103441849 12:120968879-120968901 TAGGGAAGGCCAGCCAGTGAAGG No data
1103441843_1103441849 14 Left 1103441843 12:120968842-120968864 CCAGGGCATTCTGATGCCGTAGC No data
Right 1103441849 12:120968879-120968901 TAGGGAAGGCCAGCCAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103441849 Original CRISPR TAGGGAAGGCCAGCCAGTGA AGG Intergenic
No off target data available for this crispr