ID: 1103442243

View in Genome Browser
Species Human (GRCh38)
Location 12:120971905-120971927
Sequence GGAAACACAGTGACATCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103442239_1103442243 15 Left 1103442239 12:120971867-120971889 CCCCGGGACACAGCAGACTATTT No data
Right 1103442243 12:120971905-120971927 GGAAACACAGTGACATCTGTTGG No data
1103442241_1103442243 13 Left 1103442241 12:120971869-120971891 CCGGGACACAGCAGACTATTTTA No data
Right 1103442243 12:120971905-120971927 GGAAACACAGTGACATCTGTTGG No data
1103442240_1103442243 14 Left 1103442240 12:120971868-120971890 CCCGGGACACAGCAGACTATTTT No data
Right 1103442243 12:120971905-120971927 GGAAACACAGTGACATCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103442243 Original CRISPR GGAAACACAGTGACATCTGT TGG Intergenic
No off target data available for this crispr