ID: 1103445089

View in Genome Browser
Species Human (GRCh38)
Location 12:120989199-120989221
Sequence CTGTGGGACGGGAGTAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103445083_1103445089 -3 Left 1103445083 12:120989179-120989201 CCTATTCTGCGCCAGGCACTCTG 0: 1
1: 2
2: 15
3: 183
4: 1047
Right 1103445089 12:120989199-120989221 CTGTGGGACGGGAGTAGACTTGG 0: 1
1: 0
2: 1
3: 9
4: 155
1103445081_1103445089 10 Left 1103445081 12:120989166-120989188 CCTGCATTTATTACCTATTCTGC 0: 1
1: 0
2: 8
3: 99
4: 922
Right 1103445089 12:120989199-120989221 CTGTGGGACGGGAGTAGACTTGG 0: 1
1: 0
2: 1
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103445089 Original CRISPR CTGTGGGACGGGAGTAGACT TGG Intronic
900600976 1:3502522-3502544 CTGTGGGATGGGGCTAGAATGGG + Intronic
901536019 1:9883443-9883465 CTGTGGGGCCTGAGTAGACATGG - Intronic
901650987 1:10743177-10743199 CTGGGGGACAGGAGGAGTCTGGG + Intronic
904860370 1:33533249-33533271 CTGTTGGACTGGAGGAGATTAGG + Intronic
912126769 1:106548982-106549004 CTGGGGGATGGGAATACACTAGG + Intergenic
915472860 1:156136209-156136231 CTGGGGGACAGGCGTAGCCTGGG - Exonic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
916843719 1:168627066-168627088 CTGGGGGACTGCAGAAGACTTGG + Intergenic
918069066 1:181121806-181121828 CTGTGACAAGGGAGTAGACAAGG + Intergenic
918615592 1:186540647-186540669 CTGTGGGATGGGACTGTACTAGG + Intergenic
920804544 1:209220131-209220153 CTGTGCGTAGGGAGGAGACTGGG + Intergenic
920838575 1:209534735-209534757 CTGTGGGAGGTGAGAGGACTGGG - Intergenic
1063291490 10:4754481-4754503 CTGTAGGAAGGGACTAGTCTGGG - Intergenic
1069623897 10:69855158-69855180 CTGTGTGCCAGCAGTAGACTGGG - Intronic
1069915184 10:71782845-71782867 CTATGGGACGGGAAGAGCCTGGG + Intronic
1070219061 10:74421412-74421434 CTGTGGTACTGGATTAGAGTTGG + Intronic
1070380933 10:75879581-75879603 CTGGGGGAAGGGAAGAGACTGGG + Intronic
1070764645 10:79049274-79049296 CTGGGGCAGGGGAGGAGACTTGG + Intergenic
1073047124 10:100646126-100646148 CTGAGGGAGGGGAGGAGGCTGGG + Intergenic
1079377745 11:19908856-19908878 CTGTGGGGTGGGAGTAGAGGAGG + Intronic
1079485135 11:20928234-20928256 CTGTGGTCCTGGAGTGGACTGGG + Intronic
1079722288 11:23832662-23832684 CTGTTGGACAGCACTAGACTGGG + Intergenic
1089660640 11:119982984-119983006 CTGGGGGGCGGGAGCAGCCTTGG + Intergenic
1092457639 12:8658482-8658504 CTGTGGGATTGGAACAGACTTGG - Intronic
1094299876 12:28951319-28951341 CTCTTGGATGGGAGTAGCCTTGG + Intergenic
1098250158 12:68560805-68560827 CTGTGGCACTGGAGGAGGCTAGG + Intergenic
1098567882 12:71956301-71956323 CTGTGGGAAGGGATTACACATGG + Intronic
1100020488 12:90063143-90063165 CTATGGGATGGGAGGAGCCTGGG + Intergenic
1101265402 12:103079995-103080017 CTCTGGGACGGCGGTAGAGTTGG + Intergenic
1101460771 12:104890987-104891009 GTGTGGGAGGGGAGTAGGATGGG - Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103445089 12:120989199-120989221 CTGTGGGACGGGAGTAGACTTGG + Intronic
1116790668 14:49336625-49336647 CTCTGGGACAAGAATAGACTAGG - Intergenic
1120861340 14:89257509-89257531 CTGTGGGAAGAGACTAGATTAGG + Intronic
1125404426 15:39337834-39337856 CTCTGGAACGTGAGTAGACTTGG - Intergenic
1128699631 15:69794806-69794828 CAGTGGGACGGGAGCTCACTGGG + Intergenic
1128735772 15:70053195-70053217 CTTTGGGAAGGGAGGAGTCTTGG + Intronic
1129321515 15:74777605-74777627 CTGGGGGAGGGGAGGAGGCTGGG + Intergenic
1132313770 15:100876438-100876460 CTGAGGGAGGTGAGTAGACTGGG + Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133128966 16:3664579-3664601 CCGAGGGACGGTAGTGGACTCGG + Exonic
1133365963 16:5210403-5210425 CAGTGGGAGGTGAGTAGACTAGG - Intergenic
1134439249 16:14287811-14287833 CCCTGGGAGGGAAGTAGACTAGG + Intergenic
1139591585 16:67936078-67936100 CTGTGGGGCTGGAGTAGCCGCGG - Exonic
1141574108 16:84953174-84953196 CTTTGGGATGGGAGGGGACTTGG - Intergenic
1145014592 17:19387893-19387915 CTGTGGGAGGGGAAAAGAGTGGG - Intergenic
1145320530 17:21764709-21764731 CTGTGGGAGGGGAATAGAGGTGG - Intergenic
1145973023 17:28968019-28968041 CTGTGGGAGGGGAGTTGACTTGG + Intronic
1149246401 17:54713178-54713200 CTTTGGGTCGGGTGGAGACTTGG - Intergenic
1149654240 17:58301943-58301965 CTGTGGGACACTAGTAGACGAGG + Intronic
1150226267 17:63526199-63526221 GGGTGGGATGGGAGTAGATTGGG - Intronic
1150852612 17:68718834-68718856 CTGGGGGGTGGGAGGAGACTTGG - Intergenic
1151972804 17:77467512-77467534 CGGTGGGAGGGGAGTGGAGTGGG - Intronic
1153553431 18:6285383-6285405 CTGTGGGATGGGACTGGAATTGG + Intronic
1156820132 18:41362325-41362347 GTGTGGGAAGGGGGTAGATTGGG - Intergenic
1157277104 18:46318785-46318807 CTGTGGAATGAGGGTAGACTCGG + Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1161317720 19:3625992-3626014 CTGTGGGAGGGAAAAAGACTCGG - Intronic
1161726363 19:5931532-5931554 CTGTGGGAGGGAAGGAGAGTGGG + Intronic
1162026247 19:7895576-7895598 CTGTGGGACGGGACGAGACGGGG - Intronic
1167098504 19:47389327-47389349 CTGTGGGCCGGGAGTAGGCAAGG + Intergenic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167354711 19:48996169-48996191 CTGTGGGAAGGAAGGAGACCTGG + Intronic
1168407189 19:56116839-56116861 CTGAGGGAAGGGAGCAGTCTGGG - Intronic
1168525149 19:57082704-57082726 CTGTGAGGAGGGAGTAGAGTGGG + Intergenic
926166031 2:10522558-10522580 CTGTGGGAGCTGAGGAGACTGGG - Intergenic
926166046 2:10522612-10522634 CTGTGGGAGCTGAGGAGACTGGG - Intergenic
926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG + Intergenic
927554295 2:24021625-24021647 CTGTGGGACAGGACAGGACTGGG - Intronic
927801072 2:26100173-26100195 CTGCTGGACTGGATTAGACTTGG - Intronic
928140465 2:28724124-28724146 CTGTGTGGCGGGAGTAGATCAGG - Intergenic
928292993 2:30056325-30056347 TTGTGGGAAGGGAGTAGAGAGGG - Intergenic
928508848 2:31982895-31982917 CTGTGGTACTGGATTAGAGTTGG + Intronic
932397781 2:71459986-71460008 CAGTGGGGCTGGAGTAGCCTGGG + Intronic
934921225 2:98346834-98346856 CTGTGGGACGTGAGTAAAAGGGG - Intronic
936783427 2:116062704-116062726 CTGTGGGATGCAGGTAGACTAGG - Intergenic
938663544 2:133511150-133511172 ATGGAGGACGGAAGTAGACTAGG - Intronic
944353489 2:198758042-198758064 CTGTGGGGAAGGAGTAGACTAGG - Intergenic
946372854 2:219290973-219290995 CTGGGGGAGGGGAGGACACTGGG + Intronic
946475082 2:219999402-219999424 CTCTGGTAAGGGAGTAGACTAGG + Intergenic
949025132 2:241764177-241764199 CTGTGGGAGGGGCGGGGACTGGG + Intronic
1172563315 20:35908247-35908269 CTGAGGAACAGGAGTAGACAAGG - Intronic
1174990714 20:55506287-55506309 CAGGGAGAAGGGAGTAGACTGGG + Intergenic
1176300835 21:5098229-5098251 CTGTGGGACTGGCATAGCCTAGG - Intergenic
1176306796 21:5127993-5128015 CTGGGCGGCGGGAGTTGACTGGG + Intronic
1176411075 21:6449932-6449954 CTGTGGGACGGGGGCAGGCAGGG + Intergenic
1178932229 21:36829740-36829762 CTCTGGGAAGGGAATAGAGTGGG - Intronic
1179686568 21:43058254-43058276 CTGTGGGACGGGGGCAGGCAGGG + Intronic
1179850261 21:44134037-44134059 CTGGGCGGCGGGAGTTGACTGGG - Intronic
1179856200 21:44163724-44163746 CTGTGGGACTGGCATAGCCTAGG + Intergenic
1182862723 22:33574064-33574086 ATGTGGGAAGGGACTAGACATGG + Intronic
1184216443 22:43070524-43070546 CTGTGGGGTGGGGGTAGGCTGGG - Intronic
1185049904 22:48548562-48548584 CTGGGGCAGGGGAGTGGACTGGG + Intronic
1185069409 22:48647924-48647946 CTGAGTGACAGGCGTAGACTTGG + Intronic
951528010 3:23672097-23672119 CTGAGGGAGTGGAGGAGACTTGG - Intergenic
953391187 3:42534802-42534824 CTGTGGAACAGGAGCAGACAAGG + Intronic
953664735 3:44917699-44917721 CTGGGGGTCGGGAGTAGGCTGGG - Intronic
954916461 3:54152053-54152075 CTGTGGGAATGGTGTAGACCGGG - Intronic
956045382 3:65190544-65190566 CAGTGAGACAGGAGTAGGCTAGG - Intergenic
956442523 3:69294458-69294480 CTGTGGGAGGGGAACAGTCTTGG + Intronic
960483316 3:118219825-118219847 CTGGAGGACGAAAGTAGACTAGG + Intergenic
964812509 3:160680753-160680775 CTGAGGGACGGGAAAAAACTAGG + Intergenic
969017436 4:4113292-4113314 GAGTGGGACGTGAGTAGACCAGG + Intergenic
969342388 4:6550300-6550322 CTGTGGGGAGGGGGCAGACTTGG - Intronic
972299856 4:37774316-37774338 CTGTGGGAGGTGAGTAGTCAAGG + Intergenic
972327012 4:38026333-38026355 CTGTGGGAGGGGAGGAGCCGTGG + Intronic
972709166 4:41577072-41577094 CTGTGGGACTTGAGTACACATGG + Intronic
972994883 4:44868183-44868205 CAGTGGTATGGGAGTATACTTGG + Intergenic
973720216 4:53716347-53716369 CTCTGGATCAGGAGTAGACTTGG + Intronic
975983264 4:80182858-80182880 CTTTGGGATGGGAGTAGATCTGG + Intergenic
976270393 4:83224648-83224670 CTTTGGGAGGTGATTAGACTAGG + Intergenic
979029378 4:115621379-115621401 ATGTGGGAGTGGAATAGACTTGG + Intergenic
981104448 4:140864622-140864644 CTGTGGGACTGGGGGACACTGGG + Exonic
981209967 4:142091920-142091942 GTGTGGGAAGTGAGTAGATTAGG - Intronic
981358020 4:143814091-143814113 CTGTGGAACTGGAGTAAACATGG - Intergenic
981369265 4:143940202-143940224 CTGTGGAACTGGAGTAAACATGG - Intergenic
981379010 4:144050144-144050166 CTGTGGAACTGGAGTACACATGG - Intergenic
982522309 4:156433589-156433611 CTGTGGGAATGGATTAGAATTGG + Intergenic
990267722 5:54096436-54096458 CTGGGTGACGGGACAAGACTTGG - Intronic
990320330 5:54623618-54623640 GTGTGGGAATGGAGAAGACTTGG - Intergenic
990431429 5:55738479-55738501 CAGGGGTACGGGAGTCGACTGGG - Intronic
991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG + Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
994180905 5:96765075-96765097 CTGGGGCAGGGGAGTAGACAGGG - Intronic
994947672 5:106416738-106416760 CTGTGTGAAAGGAGAAGACTTGG - Intergenic
995764163 5:115597739-115597761 CTGTGGGACTTGAGTATTCTTGG - Intronic
999169007 5:149577083-149577105 CTGTGGTATAGTAGTAGACTTGG + Intronic
999694719 5:154178930-154178952 ATGTGGGAGGGGAGTTGACCCGG + Intronic
999845517 5:155475307-155475329 CTGTGGGAAGGGTGTGGAGTTGG - Intergenic
1003068202 6:2920921-2920943 CTGTGGGCAGGGAGGAGCCTTGG - Intergenic
1005466828 6:26123869-26123891 CTTCGGGGCGGGAGCAGACTTGG + Exonic
1005470531 6:26158183-26158205 CTTTGGGGCAGGAGCAGACTTGG - Exonic
1005642308 6:27807871-27807893 CTTCGGGGCGGGAGCAGACTTGG + Exonic
1006095241 6:31652262-31652284 CCGTGGGAAGGCAGTAGACGCGG - Intronic
1007026276 6:38578238-38578260 ATGTGGGAGGGTAGGAGACTGGG - Intronic
1007100377 6:39241977-39241999 CTGTGGGGCGGGAGCAGAGGCGG - Intergenic
1007264755 6:40587833-40587855 CGGTGGGGCGGGAGTGGGCTGGG + Intergenic
1007723298 6:43898897-43898919 CTGTGGGAGGGAAGTACACAAGG - Intergenic
1008193314 6:48486882-48486904 CTGTGGGATGGGACTAGAGTGGG - Intergenic
1014434878 6:121410031-121410053 TTGTGGGATGGGAGTAGTCAGGG - Intergenic
1018040147 6:159914781-159914803 CTGTGGGACGGGGCCAGAGTGGG + Exonic
1026839867 7:73664393-73664415 CTGAGGGACAGGAGTGGGCTTGG + Intergenic
1029955499 7:104634608-104634630 CTGGGGGATGGAAGAAGACTGGG - Intronic
1033528147 7:142236939-142236961 GTGTGGGATGGGGTTAGACTGGG + Intergenic
1035002567 7:155625409-155625431 CTTTGGGATGGAAGGAGACTGGG - Intronic
1035317302 7:158004230-158004252 CTCTGGGATGGGAGGAGGCTAGG - Intronic
1038744189 8:30242419-30242441 CTGTGGGAGGGGACTACACAAGG - Intergenic
1045010175 8:97951895-97951917 CTGCGGGAAAGGAGGAGACTAGG + Intronic
1046023675 8:108697089-108697111 CTGTGGAACTGGATTAGAATGGG + Intronic
1047297811 8:123586892-123586914 CTGTGGGAAGGGATGAGGCTGGG + Intergenic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1048964330 8:139604407-139604429 CTGTGGGACGGGAGGAGGTGGGG + Intronic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1055374503 9:75634404-75634426 CTGGAGGACGGGAGAAGAATTGG + Intergenic
1056067522 9:82952587-82952609 CTGAGGGATGGGAGGAGAGTAGG + Intergenic
1056936824 9:90921422-90921444 CTGGGGGGCAGGGGTAGACTGGG - Intergenic
1057439863 9:95075067-95075089 GTGTGGGAGGGAAGGAGACTGGG - Intronic
1058886138 9:109322450-109322472 CGGTGGGAGAGGAGTAGATTGGG - Intergenic
1059948326 9:119436031-119436053 GTGTTGGACAGGAGTAGAATAGG + Intergenic
1062389848 9:136329641-136329663 GTGTGGGAAGGCAGTAGACGGGG - Intronic
1190484279 X:50909584-50909606 CTGTGGAACAGGCGTGGACTTGG - Intergenic
1193730530 X:85097205-85097227 CTGTGGGACTTGAGTAGGCATGG + Intronic
1194787794 X:98107744-98107766 CTGTGGTACTAGATTAGACTTGG - Intergenic
1197705111 X:129629349-129629371 CTGTGGGACTTGAGTATACATGG + Intergenic
1200243914 X:154512730-154512752 CTCTGGGTTGGGAGTTGACTTGG - Intronic