ID: 1103446708

View in Genome Browser
Species Human (GRCh38)
Location 12:120999605-120999627
Sequence CTGTGGGGCTGGCGCTGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 451}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103446708_1103446712 -9 Left 1103446708 12:120999605-120999627 CCGGCTCAGCGCCAGCCCCACAG 0: 1
1: 0
2: 2
3: 62
4: 451
Right 1103446712 12:120999619-120999641 GCCCCACAGGTGAGAGGCCCTGG 0: 1
1: 0
2: 1
3: 31
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103446708 Original CRISPR CTGTGGGGCTGGCGCTGAGC CGG (reversed) Exonic
900018664 1:171776-171798 CTGAGGGGACGGGGCTGAGCTGG + Intergenic
900048922 1:530371-530393 CTGAGGGGACGGGGCTGAGCTGG + Intergenic
900071153 1:772195-772217 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
900117180 1:1033772-1033794 CGCTGGGGCTGGGGCTGGGCCGG - Intronic
900476839 1:2880045-2880067 CTCTGAGGATGGGGCTGAGCTGG + Intergenic
900560735 1:3304828-3304850 CTGTGGTGCTAGGGCTGAGGAGG - Intronic
900640436 1:3685728-3685750 GAGTGGGGCTGGAGCTGAACTGG + Intronic
900854038 1:5166430-5166452 CTGAGGGCCGGGCGCTGTGCTGG + Intergenic
901756305 1:11443622-11443644 CACTGGGGCTGAAGCTGAGCTGG + Intergenic
901935451 1:12623128-12623150 GGGTGGGGCTGGGGCTGAGGGGG + Intergenic
902893149 1:19459599-19459621 CTGTGGGCCGGGCACTGTGCTGG + Intronic
903321652 1:22546909-22546931 CCATGGGGCTGGCACTGAGCAGG + Intergenic
903501554 1:23802851-23802873 CTGTGGGCCAGGCCCTGTGCTGG - Intronic
903738213 1:25543715-25543737 CGGCGGGGCGGGCGCTGATCCGG + Exonic
904297765 1:29532805-29532827 CTGTTGGGCTGTGGCGGAGCTGG + Intergenic
904588886 1:31596580-31596602 CTCTGGGGCTAGCGGTGACCTGG + Intergenic
905237003 1:36557178-36557200 CTGCGGGCCTGGAGCTGGGCAGG + Intergenic
905242146 1:36588264-36588286 CTGTGTGCCAGGCCCTGAGCTGG - Intergenic
905272916 1:36798506-36798528 CAGTGGGCATGGAGCTGAGCTGG - Exonic
905435307 1:37951574-37951596 GTGTGGGGCTGGGGCTGTGAGGG - Intergenic
905678017 1:39843488-39843510 GGGTGGGGCTGGCCCTGAGGTGG + Intronic
906136876 1:43506228-43506250 CTGTGGGGCTGGGCTGGAGCTGG - Intergenic
906212549 1:44020156-44020178 CTGTGTGCCAGGCCCTGAGCCGG + Intronic
906797926 1:48712246-48712268 CTGTGGGCCAGGCACTGTGCTGG + Intronic
907313599 1:53553837-53553859 CTGTGTGGCTGGAGCAGAACGGG + Intronic
907906397 1:58785986-58786008 CTGTGAGCCAGGCACTGAGCTGG + Intergenic
912127332 1:106555321-106555343 CTATGTGGCTGTGGCTGAGCTGG - Intergenic
912207342 1:107523218-107523240 CTGTGTGGCTGGAGCAGAACAGG - Intergenic
912558368 1:110532347-110532369 CTGTGTGCCTGGCACTGTGCTGG + Intergenic
912631167 1:111247891-111247913 CTCTGTGGCTGGCACTGAGCGGG - Intergenic
913194530 1:116444670-116444692 CAGTGGGGCTGGGGCTGGGCTGG - Intergenic
915095624 1:153460255-153460277 CTGTGGAGCTGGAGCTGGGGAGG + Intronic
915098850 1:153484229-153484251 CTGTGGGGCAGGCCTTGTGCTGG - Intergenic
915345426 1:155194744-155194766 CCCTGGGGCAGGCGCTGGGCGGG + Intergenic
915810925 1:158909830-158909852 CTGTGGGCCTGGGGCAGTGCTGG + Intergenic
915822992 1:159045396-159045418 GTGTGGGGATGGCTCTCAGCTGG - Exonic
915823352 1:159049531-159049553 GTGTGGGGATGGCTCTCAGCTGG - Intronic
917963822 1:180166156-180166178 CTGGGGGGATGGCGAGGAGCAGG + Intronic
919057055 1:192584253-192584275 CTATGGGGCAGGCACTGTGCTGG + Intergenic
919823691 1:201489031-201489053 AGGTGGGGCTGGCACTGAGAGGG + Intronic
919828674 1:201522774-201522796 CTGTGGGGGTGGGGCAGGGCAGG + Intergenic
919991303 1:202710000-202710022 CTGAGGGACTGGGGCTGGGCTGG - Intronic
920451174 1:206062351-206062373 CTCTGGGGCTGGGGGTGATCTGG - Intronic
920524797 1:206658722-206658744 CGGTGGGCCAGGCGCTGTGCTGG + Intronic
920869795 1:209784521-209784543 CTGCGGGACTGGAGCAGAGCGGG - Exonic
922106512 1:222517644-222517666 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
922541015 1:226419615-226419637 CTGTAGGGCTGGGGCTGATGTGG + Intergenic
923526774 1:234778819-234778841 CTGTGGCGCTGGCCTTGTGCTGG - Intergenic
924348698 1:243095210-243095232 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1062893293 10:1082756-1082778 CTGTGCTGCTGGAGCTGTGCAGG - Intronic
1063188106 10:3668485-3668507 ATCGGGGGCTGGAGCTGAGCGGG + Intergenic
1063458691 10:6202439-6202461 CTGTGGGGCAGGCGCAGTCCAGG - Intronic
1063558667 10:7105746-7105768 CTGTGGGCATGGGGCTGGGCTGG - Intergenic
1065092847 10:22252509-22252531 GCGCGGGGCTGGCGCTGCGCAGG - Intergenic
1066658150 10:37713390-37713412 CTGTGGGGTTGGCATTGGGCTGG + Intergenic
1066711005 10:38233753-38233775 GTGTGGGTCTGGCCCTCAGCAGG + Intergenic
1067202545 10:44185902-44185924 CTGTGTGCCAGGCGCTGTGCTGG + Intergenic
1067756258 10:49008132-49008154 GTGTGGGACTAGCCCTGAGCTGG + Intergenic
1069708861 10:70476504-70476526 CTGGGGGGCTGGTGGTGGGCTGG + Intergenic
1069752743 10:70754612-70754634 CAGTGGGGCTGGAGCTGACTGGG + Intronic
1069802970 10:71093689-71093711 CTGTGGGTCTGGGCCTGACCTGG + Intergenic
1070372986 10:75803173-75803195 TTGTGGGGCTGAGGCTGGGCTGG - Intronic
1072188611 10:93063424-93063446 GTCCGGGGCTGGCGCTGGGCTGG - Intronic
1072693177 10:97584729-97584751 CTGTGAGGCAGGGGCTAAGCAGG + Exonic
1074190492 10:111131022-111131044 TTGAGTGGCTGGAGCTGAGCTGG + Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075004536 10:118820530-118820552 CTGTGGGGCGGGGGCTGGGGAGG - Intergenic
1076875757 10:133214774-133214796 CTGTGGGGCTTGGGCTGGACTGG + Intronic
1076975266 11:166972-166994 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077146830 11:1050212-1050234 AGGAGGGGCTGGCTCTGAGCTGG + Intergenic
1077288271 11:1777302-1777324 CTGAGGAGCTGGGGCTGGGCTGG + Intergenic
1077305886 11:1868547-1868569 CTGCTGGGCTGGCCCTGAGGGGG + Intronic
1077319778 11:1935987-1936009 CAGAGGGGCTGGCCCTGAGACGG + Intronic
1077965000 11:7120369-7120391 CTGTGGGGCTGGAGCTAAAAAGG + Intergenic
1078302619 11:10148198-10148220 ATTTGGGGGTGGCGGTGAGCAGG + Intronic
1078663283 11:13304252-13304274 CAGAAGGGCTGGCCCTGAGCCGG + Intronic
1079101261 11:17543727-17543749 CTGAGGAGCTGGTGCTGACCCGG - Intronic
1079317253 11:19419112-19419134 CTGGGGGGCTGGCACTGTGCTGG + Intronic
1080245259 11:30172924-30172946 TTGTGTGGCTGGCTCAGAGCTGG - Intergenic
1080385813 11:31810571-31810593 CGCTGGCGCTGGGGCTGAGCTGG + Intronic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1081578138 11:44332455-44332477 CTATGGGGCTGGCTCTGTGCTGG - Intergenic
1081733003 11:45384734-45384756 CTGTGGGGCTGGCGTTGGGGAGG - Intergenic
1081816373 11:45945842-45945864 CTGTGGAGGTGGGGCTGGGCAGG + Exonic
1082210785 11:49498653-49498675 ATGTGTGGCTGGAGGTGAGCTGG - Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083340518 11:61955887-61955909 CTGCGGTGCTGACGCTGCGCAGG - Exonic
1083491507 11:63017662-63017684 CTGTGAGGCTTGCAGTGAGCTGG + Intergenic
1083627274 11:64078165-64078187 CTCTGGGGCGGGCACAGAGCTGG - Intronic
1083629531 11:64088447-64088469 CTGTGGGCCTGGGGCAGGGCAGG + Intronic
1083725644 11:64626728-64626750 GGGTGGGGCTGGCTCTGAACCGG - Intronic
1083808788 11:65090715-65090737 CTGTGGGTCTTGGGCTGACCTGG - Intronic
1084178669 11:67436092-67436114 CTGGGGGGCTGGCCCAGAGCAGG + Exonic
1084420091 11:69056175-69056197 CGGCAGGGCTGGCGCTGAGGAGG - Intronic
1084588892 11:70078949-70078971 CTGGGGGCCCGGCGCTGCGCTGG - Intronic
1085276961 11:75306674-75306696 CTGCGGGGCTGGCCCTGGCCTGG - Intronic
1085508710 11:77074519-77074541 GATTTGGGCTGGCGCTGAGCTGG - Intronic
1085519443 11:77129525-77129547 CTCTGGGTCTGGCCCTGTGCTGG + Intronic
1085729444 11:78983782-78983804 CTGTGGGGGTGGGGCTGGGTGGG + Intronic
1086638854 11:89126136-89126158 ATGTGTGGCTGGAGGTGAGCTGG + Intergenic
1088411469 11:109539358-109539380 CTGTGGGCCTGGAGCTGTGGTGG - Intergenic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1090414225 11:126529447-126529469 CTGATGGGATGGGGCTGAGCGGG + Intronic
1091460823 12:642710-642732 CTGCGGGGCTAGTTCTGAGCCGG + Intronic
1094025783 12:25958772-25958794 CTGGGCGGCAGACGCTGAGCGGG - Intergenic
1094042665 12:26133884-26133906 CAGTGGAGCTGGTGCTGAGTTGG + Intronic
1096181733 12:49554849-49554871 CTGGGGGTCAGGGGCTGAGCAGG + Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1098836076 12:75425542-75425564 CTTAGGGGCTGGCCCTGTGCTGG - Intronic
1101797897 12:107992835-107992857 CTGTGTGCCTGGAACTGAGCTGG + Intergenic
1102232152 12:111270127-111270149 CTGGGGGGCCGGCAGTGAGCGGG - Intronic
1102470784 12:113158783-113158805 CTGTGTGCCTGGCCCTGTGCTGG - Exonic
1102487259 12:113266738-113266760 CTGCGGGGCTGGGGCTGCCCAGG - Intronic
1102952983 12:117042357-117042379 CTGGGGGGCTGGTGGTGAGGTGG - Intronic
1103209145 12:119154199-119154221 CTGGGGAGCTGGGGCTGGGCTGG - Intronic
1103446708 12:120999605-120999627 CTGTGGGGCTGGCGCTGAGCCGG - Exonic
1103948367 12:124539357-124539379 CAGTGGGCCTGGGCCTGAGCTGG - Intronic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1104288828 12:127449840-127449862 CAGTGGGGCTGGCCCTGGGGTGG - Intergenic
1104729180 12:131095552-131095574 CTGTGGGGCTGAGGGTGGGCCGG + Intronic
1105302797 13:19150930-19150952 GGGTGAGGGTGGCGCTGAGCTGG + Intergenic
1105874538 13:24540816-24540838 CTGTGGCTCTGAGGCTGAGCCGG + Intergenic
1106411416 13:29514037-29514059 CTGGGTGTCTGGGGCTGAGCGGG + Exonic
1107013821 13:35693626-35693648 CTGTGGGGATAGCTCTGGGCAGG - Intergenic
1108712409 13:53046600-53046622 CTGTGTGGCTGGCCCTGTTCTGG + Intronic
1113583772 13:111448811-111448833 CTGTGGGGCTGGCACCCACCTGG - Intergenic
1113784866 13:112997140-112997162 CTCTGGGTCTGCCACTGAGCTGG - Intronic
1113811613 13:113146171-113146193 CTGTGTGTCAGGCACTGAGCCGG + Intronic
1113868925 13:113546313-113546335 CCGTGGGGCTGGGGCTGATGAGG + Intronic
1113945739 13:114043155-114043177 GTCTGGAGCTGGTGCTGAGCTGG - Intronic
1114618019 14:24078429-24078451 CTGTGGGGCGGGCCAAGAGCAGG + Intergenic
1114648506 14:24268852-24268874 CTGTGGGCCTGGTGCTGATGGGG - Intronic
1118252089 14:64171677-64171699 CAGTGTGACTGGCGCAGAGCTGG + Intronic
1118312573 14:64704561-64704583 CTGAGGGGCTGGCGGTGGGCGGG + Exonic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119375735 14:74191120-74191142 CTGTGGCTCTGGCGCAGAGCTGG - Intronic
1121319240 14:92981466-92981488 CTGTGGGGCTCTCGCGGAGGTGG - Intronic
1122027365 14:98887372-98887394 CTGTGGGGCAGGCCCTGGTCTGG - Intergenic
1122052085 14:99067295-99067317 GGCTGGGGCTGGGGCTGAGCTGG - Intergenic
1122863855 14:104594786-104594808 CTTTGGTGCTGGCGCTGGGTGGG - Intronic
1122942062 14:104985902-104985924 CCGTGGGCCAGGCGCTTAGCCGG + Exonic
1123111343 14:105868350-105868372 GTGAGGGGCTGGCTCTGGGCTGG + Intergenic
1124401125 15:29348458-29348480 GCGTGTGGCTGGAGCTGAGCTGG + Intronic
1125356416 15:38821254-38821276 ATGTGGGTCTGGCACTGTGCTGG + Intergenic
1125499776 15:40232358-40232380 CTGGTGGGCTGGGGCTGAGATGG + Intergenic
1125722521 15:41852105-41852127 CAGTGGGGCTGGGGCTGTGGGGG - Intronic
1126194548 15:45917681-45917703 CTGGGGGCCTGGCACTCAGCTGG + Intergenic
1127993022 15:64134641-64134663 CTGTGGGGGTGGGGTTGAGGAGG - Intronic
1128071784 15:64801855-64801877 CAGTGTGCCTGGCCCTGAGCTGG - Intergenic
1128869373 15:71141237-71141259 CTGTGGGTCAGGCACTGTGCTGG + Intronic
1129150445 15:73684681-73684703 CTGTGGGGCCCGCGGAGAGCTGG + Intronic
1129156583 15:73721970-73721992 TTGTGGACATGGCGCTGAGCCGG - Intergenic
1129296772 15:74604167-74604189 CTGTGGGGCTGGAGGTGTGTGGG + Intronic
1130879320 15:88041593-88041615 CTGAGGGACTGGGGCTGAGTGGG - Intronic
1131265387 15:90912410-90912432 CTGTCAGGCTGGAGCTGAGATGG - Intronic
1131367599 15:91853509-91853531 CCTTGGGGCTGGGGCTGAGGGGG + Intergenic
1132110292 15:99097751-99097773 CTGTGTGCCTGGTGCTGGGCTGG - Intergenic
1132238470 15:100239511-100239533 CTGTGTGGATGCCCCTGAGCGGG + Intronic
1132481845 16:170274-170296 CTGTGGGGCAGGGGCTGGGCTGG - Intergenic
1132670078 16:1098931-1098953 CTGTGGGGCTGGAGCAGACACGG + Intergenic
1132690813 16:1181099-1181121 CTGTGGGGCCTGCTCCGAGCTGG - Intronic
1132815914 16:1826536-1826558 CGCTGAGGCTGGCGCGGAGCGGG - Intronic
1132909121 16:2299329-2299351 AGGCGGGGCTGGCGCTGAGATGG + Intronic
1133050545 16:3115106-3115128 GTGTGAGGCTGGAGCTGAGAAGG + Intronic
1133102298 16:3486722-3486744 CAGTGGAGAGGGCGCTGAGCTGG - Exonic
1133136085 16:3713020-3713042 CTGTGGTGCTGGCACTTAGACGG - Intronic
1133464838 16:6019477-6019499 CTGGGGGGCTGGGGCGGAGGGGG - Intronic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1134044534 16:11091521-11091543 CTGAGGGGCTGGCACTGCACAGG + Intronic
1134066024 16:11228887-11228909 CAGTGTGCCTGGCGCGGAGCAGG - Intergenic
1135422822 16:22316399-22316421 CTTGGGGGCTGGGGCTGGGCAGG + Intronic
1135474629 16:22763295-22763317 TTTTGGGGCTGGAGCTGACCAGG + Intergenic
1136139156 16:28277680-28277702 CTCTGGGGCTGGCACAGACCGGG + Intergenic
1137360047 16:47805983-47806005 CTGTGAGGCTGGGGTTGAGTTGG + Intergenic
1138180038 16:54935037-54935059 CTGCGGGGCTGGGGTCGAGCGGG + Intergenic
1138578985 16:57927347-57927369 CGGTGGGGCTGACTGTGAGCAGG - Intronic
1139340616 16:66265654-66265676 CTGTGCGGCTGGCAGAGAGCAGG - Intergenic
1139482229 16:67236865-67236887 CTGTGGGGCGGGGCCTGAGGGGG + Intronic
1139570094 16:67806426-67806448 CTGGGGAGCAGGAGCTGAGCCGG - Exonic
1139954093 16:70685198-70685220 CTGTGGGGGTGGGGCGGGGCTGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141661156 16:85442329-85442351 ATGTGGGGCTGATGCTGAGATGG - Intergenic
1141680163 16:85539026-85539048 CCGCGGGGCTGGCACTGTGCAGG - Intergenic
1142112816 16:88341266-88341288 CTGAGGGGCTGGCCCTGTACAGG - Intergenic
1142143459 16:88482907-88482929 CTCTGGGGTCGGCCCTGAGCAGG - Intronic
1142444994 16:90130687-90130709 CTGAGGGGACGGGGCTGAGCTGG - Intergenic
1142462516 17:104779-104801 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1142591625 17:1008698-1008720 CGGGGGGCCTGGCCCTGAGCTGG + Intronic
1142859955 17:2755531-2755553 CTGCGGGGCCGGCGCTGACCCGG + Intergenic
1143015074 17:3887341-3887363 CGGTGGGGCTGGTGCTGACATGG + Intronic
1143096906 17:4483081-4483103 CTGGGGGGCAGAGGCTGAGCAGG - Intronic
1143707726 17:8711016-8711038 CTGTGGGGCTAGCTGTCAGCTGG - Intergenic
1143709829 17:8726622-8726644 CTGTAGGGGTGGTGCTGAGGGGG + Intergenic
1144624391 17:16837406-16837428 CTGTGTGCCTGGCACTGTGCTGG + Intergenic
1146576828 17:34001449-34001471 CAGTGGGGCTGGTGCTGGTCTGG + Intronic
1146973665 17:37093021-37093043 CTATGGGCCTGGAGCTGAGATGG - Intronic
1147044739 17:37744274-37744296 CCGCGGGGCTGGGGCTGGGCCGG - Intronic
1147159219 17:38560831-38560853 CTGTGTGGCAGGCGCTGCACAGG - Intronic
1147248200 17:39136021-39136043 CTGTGTGTCTGGTCCTGAGCAGG + Intronic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1148678660 17:49460076-49460098 CTGTGGGCCAGGCACTGTGCTGG - Intronic
1148778678 17:50109864-50109886 CAGCTGGGCTGCCGCTGAGCTGG + Intronic
1148783875 17:50135792-50135814 CTGGGGGTCTGGCTCTGTGCTGG + Intronic
1148865149 17:50624428-50624450 CTGTGGGGCTGGAGCAGATGAGG - Exonic
1149329962 17:55570464-55570486 CTGTGAGGCTGTGGCTGACCAGG - Intergenic
1149988902 17:61369439-61369461 CAATGGGGCAGGCGCTGATCAGG + Intronic
1150063321 17:62087692-62087714 CTGTGGGCCTAGCTCTGAGAAGG + Intergenic
1151318654 17:73339161-73339183 CTATGGGGTTGGCCCAGAGCTGG + Intronic
1151356241 17:73560274-73560296 CTGCAGGGCTGGAGCTGGGCTGG + Intronic
1151470550 17:74315104-74315126 CTGTGGGCCAGGTGCTGTGCAGG + Intergenic
1152049201 17:77959129-77959151 CCGTGGCGCCGGCGCTGAGCGGG + Intergenic
1152240700 17:79159407-79159429 CTGTGCGGCTTGGGCTAAGCCGG - Intronic
1152290828 17:79439091-79439113 CTGTCCCTCTGGCGCTGAGCAGG + Intronic
1152408785 17:80111810-80111832 CTGTGGGGCTGGCGTTACCCGGG - Intergenic
1152600156 17:81258272-81258294 CTGCCGGGCTGAGGCTGAGCTGG - Intronic
1152751691 17:82065370-82065392 CCGCGGGCCTGGCCCTGAGCAGG + Exonic
1152754166 17:82080190-82080212 CTGTGAGGCTGAGGCTGAGACGG - Exonic
1152932404 17:83116553-83116575 CAGTGGGACTGGAGTTGAGCTGG - Intergenic
1153183177 18:2459054-2459076 CTGTGGGCCTTGAGCTGTGCTGG - Intergenic
1153676503 18:7460293-7460315 CTGCGGGCCAGGCGCTGGGCTGG + Intergenic
1153991745 18:10406501-10406523 CTTTGGGGCTGCTGCTGAGCTGG - Intergenic
1154172963 18:12063913-12063935 CTGGGGGCCTGGAGCAGAGCAGG + Intergenic
1155597234 18:27502289-27502311 CTGTCCTGCTGGGGCTGAGCTGG - Intergenic
1157600088 18:48888370-48888392 CTGTGAGGCTGGCACAGAGGGGG + Intergenic
1158814164 18:61074439-61074461 CAGTGGGGCTGGCTCTAAACAGG + Intergenic
1160338039 18:78060159-78060181 CTGAGGGTCTGGGGCTGAGTGGG - Intergenic
1160509911 18:79447581-79447603 CTCTGAGGCTGGCGCTCATCGGG + Intronic
1160575767 18:79852975-79852997 CCGTGGGGCAGGCCCTGGGCTGG + Intergenic
1160652223 19:237155-237177 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1160859198 19:1230616-1230638 GCGTGGGGCTGGGGCAGAGCAGG - Exonic
1161224322 19:3136157-3136179 CTGTCGGGCCGGGTCTGAGCAGG + Intergenic
1161618040 19:5283169-5283191 CCGTGGGGCTGGCCCCGGGCAGG - Intronic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162582556 19:11539869-11539891 CTCTGGGGCCGGCGCTGGGGGGG - Intronic
1162728137 19:12701952-12701974 CTGTGGGGGTGGGGCAGGGCAGG + Intronic
1162799050 19:13101079-13101101 GGGTGGGGCAGGCGCTGGGCTGG + Exonic
1162994266 19:14323954-14323976 CAGTGGGGCAGGAGCTGATCGGG - Intergenic
1163482726 19:17567561-17567583 CTGTGGGGACTGGGCTGAGCAGG + Intronic
1163575625 19:18109585-18109607 CCGTGGGGTTTGCGCTGAGAGGG + Intronic
1163601580 19:18252268-18252290 CTGTGGAGCTGGGGCTCGGCTGG + Intronic
1163622646 19:18369971-18369993 TTGTGGGGCTGGAGTTCAGCTGG + Intergenic
1163735804 19:18979838-18979860 CTGTGTGCCAGGCACTGAGCTGG + Intergenic
1163745601 19:19044667-19044689 CTGTGGGCCTGGTTCTGTGCAGG + Intronic
1163769514 19:19182355-19182377 CTGTGTGCCTGGCCCTGGGCTGG - Intronic
1164811668 19:31162200-31162222 CTGTGGGCCAGGCACTGTGCTGG - Intergenic
1165031252 19:32999512-32999534 CTCTGTGGCTGGCTGTGAGCAGG + Intronic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165504842 19:36219267-36219289 CTGCGGGGGTGGGGCTGAGGTGG - Intronic
1165642081 19:37398319-37398341 CTGTGGGGGTGGGGCTGCTCAGG - Intergenic
1166351497 19:42200674-42200696 CTCTGGGGCTGGCCCTGCGTAGG - Intronic
1166840261 19:45692879-45692901 CTGAGGAGCTGCCGCTGGGCCGG + Exonic
1167358153 19:49016493-49016515 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167359648 19:49023383-49023405 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167361483 19:49032702-49032724 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167362171 19:49036083-49036105 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167363913 19:49044775-49044797 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167364585 19:49048152-49048174 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167365870 19:49054788-49054810 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167385557 19:49160984-49161006 CAGTGGGGCTGTCCCTGAGATGG + Intronic
1167487708 19:49772862-49772884 CTGTGTGGCTGGTGCAGAGAGGG + Intronic
1167569930 19:50280598-50280620 CACTGGAGCTGGGGCTGAGCTGG - Intronic
1167746830 19:51356586-51356608 CTGTGTGCCTGGCTCTGAGCTGG + Exonic
925020133 2:562588-562610 CTGTGGGGCTGCCGCGTAGGGGG + Intergenic
927515080 2:23667614-23667636 CAGTGGTGGTGACGCTGAGCAGG - Intronic
927518411 2:23685427-23685449 CTCCGGGGCAGACGCTGAGCCGG + Intronic
929539629 2:42810101-42810123 GGCTGGGGCTGGGGCTGAGCCGG - Intergenic
929829518 2:45335624-45335646 CTCTGGTGCTGTGGCTGAGCAGG - Intergenic
930605682 2:53490728-53490750 CTGTGGAGCTTGTGCTGAGAGGG - Intergenic
932056560 2:68449113-68449135 CTGCGGGGCTGGCGTTGTGCGGG - Intergenic
933771172 2:85745083-85745105 CTGTGGGGCTGCCCTCGAGCTGG + Intergenic
934153244 2:89170543-89170565 CTGTGCTGCTGGGGCTAAGCAGG + Intergenic
934213991 2:90011388-90011410 CTGTGCTGCTGGGGCTAAGCAGG - Intergenic
934723928 2:96602753-96602775 CTGTGGGGCTGGTCCTGGGGAGG + Exonic
934778091 2:96951466-96951488 CTGTTGGGCTGGCGGGGAGCTGG + Exonic
934943337 2:98518461-98518483 CTGTGGTGCTGGGACTGAGTGGG + Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
938234977 2:129698740-129698762 CTGTGGAGCTGGCTGTGTGCCGG - Intergenic
938310477 2:130285748-130285770 CTGGGGGCCTGGAGCAGAGCAGG - Intergenic
938444452 2:131366619-131366641 CTGGGGGCCTGGAGCAGAGCAGG + Intergenic
939238633 2:139530513-139530535 CTGTTGGTCTGGCACTGTGCAGG + Intergenic
939628508 2:144508167-144508189 CTGTGATGCTGGCGCTGCCCGGG + Intronic
942251087 2:174048442-174048464 CTGCGGGCCTGGCGGGGAGCCGG - Intergenic
943027476 2:182647132-182647154 CTGAGGGGCTGGTCCTCAGCTGG - Intergenic
944898480 2:204190172-204190194 GTGTGGGGCTTGCGGTGAGCGGG - Intergenic
946404073 2:219483573-219483595 CTGTGGAGCTGCCGCAGCGCCGG + Exonic
948154138 2:235767687-235767709 CTGTGGGGTTGGCAGTGGGCTGG + Intronic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948921261 2:241066972-241066994 ATGTGCGGGTGGCACTGAGCAGG + Intronic
1168745200 20:233359-233381 CTGTGGGGCAGGGGCTGTGGGGG + Intergenic
1168854054 20:996691-996713 CTGTGGGCCAGGCCCTGGGCTGG - Intronic
1170481139 20:16765991-16766013 TTGTGGGGCTGGCAGGGAGCTGG + Intronic
1171191369 20:23161833-23161855 CTGTTGGGCTGGTGCATAGCAGG + Intergenic
1171977401 20:31604317-31604339 CTGTCAGGCTGGCGCCGCGCGGG - Intergenic
1172062690 20:32197147-32197169 CTGTGGAGCTGCAGCTGAGTAGG + Exonic
1172181854 20:33008416-33008438 CTGTGGGCCTGGGGCAGGGCTGG + Intronic
1172182703 20:33013414-33013436 CTGTGGGCCAGGCTCTGTGCTGG + Intronic
1172360948 20:34312199-34312221 CTGTGTGCCAGGCACTGAGCTGG - Intergenic
1172446986 20:34998420-34998442 CGGTGAGGCTGGGGCTCAGCTGG + Exonic
1172518690 20:35553639-35553661 CTGTGGGGGTGGGGCTGTGTTGG + Intronic
1172773521 20:37394802-37394824 CTGTGGGCCTGGGGCTCAGCGGG + Intronic
1172885303 20:38227094-38227116 TTGTTGGGCTCGAGCTGAGCTGG - Intronic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1174077223 20:47946253-47946275 CTGTGGGGGTGGCAGGGAGCAGG + Intergenic
1175344234 20:58260265-58260287 CTCTGGGCCTGGCACTGTGCTGG + Intergenic
1175643140 20:60648689-60648711 CTGTGGGGGTGGTGCAGTGCCGG - Intergenic
1176121090 20:63454912-63454934 CTGTGGGCCTGGGTCTGAGGTGG - Intronic
1177414929 21:20781041-20781063 CTCTGGGGCTTGGACTGAGCTGG + Intergenic
1178791973 21:35708900-35708922 CCGTGGGGCAGAGGCTGAGCTGG - Intronic
1179164017 21:38921099-38921121 GTCTGGGGCTGGCTCTGGGCTGG - Intergenic
1179661619 21:42879463-42879485 CTGTGGGACTGGCGTTGTGCGGG - Exonic
1180060783 21:45383858-45383880 CGGTGGGGCTGGCTTTGAGCAGG - Intergenic
1180156958 21:45982535-45982557 CTGTGCTGCAGGCGCTGGGCTGG + Intronic
1180786063 22:18548491-18548513 CTGTGGTGGTGGGGCTGAGCCGG + Intergenic
1180841840 22:18962517-18962539 GTGAGGGACTGGGGCTGAGCAGG + Intergenic
1180970196 22:19811284-19811306 CTTTGGGGCTGGTACTGGGCAGG - Intronic
1181059664 22:20276347-20276369 GTGAGGGACTGGGGCTGAGCAGG - Intronic
1181131345 22:20734216-20734238 CTGTGGTGGTGGGGCTGAGCCGG + Intronic
1181242985 22:21488045-21488067 CTGTGGTGGTGGGGCTGAGCCGG + Intergenic
1181520559 22:23447029-23447051 CTGAAGGGCTGGCGCTGATGCGG + Intergenic
1181750064 22:24983014-24983036 CTGTGGGCCAGGCTCTGTGCTGG + Intronic
1181769403 22:25114353-25114375 CTGTGTGCCTGGCACTGTGCTGG - Intronic
1182189504 22:28443688-28443710 CTGTGTGGCTGAAGCTGGGCTGG - Intronic
1182414185 22:30210445-30210467 CTCAGGGGCTGGCTCTGGGCAGG + Intergenic
1182434914 22:30324446-30324468 CTGTAGGGCTGGGGCTGAGGTGG - Intronic
1183272018 22:36868222-36868244 CTGTGAGGATGCCGCTGGGCTGG - Intronic
1183301219 22:37060082-37060104 CTGTGGGGAGAGGGCTGAGCGGG + Intronic
1183319685 22:37157372-37157394 CTGGGGGGCTGGCGTGGAGGTGG - Intronic
1183326838 22:37199023-37199045 CAGAGGGCCTGGCGCGGAGCTGG - Intronic
1183472513 22:38017073-38017095 CTGTGGGGCCGTGCCTGAGCGGG + Intronic
1183674669 22:39292601-39292623 CTGTGGGCCAGGCCCTGTGCCGG + Intergenic
1183715666 22:39532261-39532283 CTGTGTGCCAGGCGCGGAGCGGG - Intronic
1183780581 22:39996125-39996147 CTGTGTGCCTGGCCCTGTGCTGG + Intronic
1184110147 22:42389584-42389606 TTGTGGGGCTGGGGCTGGGCTGG + Intronic
1184521947 22:44999841-44999863 GTGGGGCGCTGGCTCTGAGCAGG - Intronic
1184539017 22:45107447-45107469 CTGTAGGGCAGGGGCTGAGCTGG + Intergenic
1184664250 22:45978916-45978938 CTGTCGGGCTGTGGCGGAGCTGG + Intergenic
1184758707 22:46532918-46532940 CTCTGGGGCTGGAGGTGAACAGG - Intronic
1184907372 22:47497887-47497909 CTGTGGGGCAGGGCCTGAGTGGG + Intergenic
1185107639 22:48883362-48883384 CTGTGCTGCTGGCGCTCGGCTGG + Intergenic
1185139054 22:49090127-49090149 CCGGGGGGCAGGAGCTGAGCCGG + Intergenic
1185316735 22:50182571-50182593 AGGTGGGGCTTGAGCTGAGCCGG + Intergenic
1185392589 22:50570712-50570734 CTGTGGTCCTGGGACTGAGCAGG - Intronic
949926839 3:9048347-9048369 CTGGGGAGCTGGAGATGAGCTGG - Intronic
950467177 3:13162400-13162422 CCCTGGGGCTGGCTCTGAGGTGG - Intergenic
950467988 3:13166768-13166790 CTTGGGGCCTGGCACTGAGCAGG + Intergenic
950550095 3:13661172-13661194 ATGTGGGGCTGTCGCAGGGCGGG + Intergenic
950769950 3:15303349-15303371 CTGTGTGGCAGGCTCTGGGCTGG - Intronic
951211527 3:19980787-19980809 CTCTGGGACTGGCTCTGGGCTGG - Intronic
951906790 3:27714600-27714622 GTGTGGGGAAGGCGCTGACCAGG + Intergenic
952045897 3:29319537-29319559 CTGTGGGCCAGGCACTGTGCTGG + Intronic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
954289484 3:49642189-49642211 CTGTGGGGCCTGCACTGACCTGG + Intronic
954685826 3:52369687-52369709 CTGTGGGGCAGGGGCAGTGCTGG - Intronic
954735751 3:52705615-52705637 CTGCGGCGCGGGCGCTGAGCTGG - Exonic
954912637 3:54122210-54122232 CTCTGGGGCTGGCCCCGGGCCGG - Intergenic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
960672449 3:120166445-120166467 GTGTAGGGGTGGCTCTGAGCTGG + Exonic
961391195 3:126553201-126553223 CTGTGGGGCTGCAGCTGGGAGGG - Intronic
961867749 3:129966395-129966417 CTGTGGGGCTGGCGTGGAGCTGG - Intergenic
962243563 3:133771999-133772021 TGGAGGGGCTGGTGCTGAGCCGG - Intronic
962748340 3:138414249-138414271 TTGTGGGGCAGGCTCTGAGCTGG + Intergenic
963511148 3:146250951-146250973 CTGCGGGGCAGGCGGTGAGTGGG - Exonic
964305317 3:155333434-155333456 CTGAGGGTCTGGAGCTGGGCCGG + Intergenic
967819906 3:193831004-193831026 CTGTAGGGCTGTTTCTGAGCAGG + Intergenic
967970942 3:194999135-194999157 CTCTGGGGCTGGGGCTGGGCTGG - Intergenic
968365610 3:198182817-198182839 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
968556034 4:1246984-1247006 CTGTGGGCTTGGCGCAGAGCCGG - Intronic
968571885 4:1346551-1346573 CTGTGCGTCTGGCGCCGAGGTGG + Intergenic
968944558 4:3656768-3656790 CTGTGGGTCTGGCGCGTGGCAGG + Intergenic
969036344 4:4256895-4256917 CTGTGGAGCTGGCACTGAGTGGG - Intergenic
969340122 4:6535175-6535197 CTGTCAGGCTGGCGCTGTGTCGG + Intronic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
971401394 4:26279092-26279114 CTGTGGGCCAGGCACTGTGCTGG - Intronic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
973257500 4:48128048-48128070 CTGTGGGGCCCGGGCTGCGCGGG + Intronic
973295542 4:48515999-48516021 CTGTGGGGCTGCCACACAGCAGG + Intronic
975219446 4:71797411-71797433 CTGCGAGGCTGCAGCTGAGCGGG - Intronic
977206567 4:94170143-94170165 CTGGGAGGCTGGGGCTGCGCAGG - Intergenic
977323588 4:95548749-95548771 CAGTGCCGCTGGCGCTGAGCAGG + Exonic
977708540 4:100098350-100098372 TTGTGGTGCTGGCTCTTAGCTGG - Intergenic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979254644 4:118597984-118598006 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
979334317 4:119448047-119448069 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
980108842 4:128615212-128615234 CTGTGGGCCTGTCTCTGAGGAGG - Intergenic
983310679 4:166057263-166057285 CTGTGAGCCTGGCTATGAGCTGG + Exonic
984712710 4:182899136-182899158 CTGTGGAGCTGGCTCTCATCAGG - Intronic
985487659 5:160808-160830 GAGTGGGGGTGGCGCAGAGCTGG - Intronic
985727110 5:1522409-1522431 CTCTGGGGCTGGGGCGGTGCCGG - Intronic
985795136 5:1956415-1956437 CTGTGGGGCGTGCACTGAGATGG + Intergenic
985802039 5:2010825-2010847 CTGTGGGGCTCGCCATCAGCGGG - Intergenic
985910145 5:2872937-2872959 CACTGGGACTGGGGCTGAGCTGG - Intergenic
985988245 5:3535323-3535345 CTGTGAGGCCGGCGCTTGGCCGG - Intergenic
986351572 5:6885186-6885208 CTTTGGGGCTGGCACTGTTCTGG + Intergenic
987797090 5:22641590-22641612 CTGTGTGGCTTGGGCAGAGCAGG - Intronic
991169493 5:63604364-63604386 CTGCTGGGCTGGGGGTGAGCTGG + Intergenic
991478530 5:67050421-67050443 CTGAGGGGCAGGAGGTGAGCAGG - Intronic
995450076 5:112290857-112290879 CTGTGTGGGTGGTGCTGAGCAGG - Intronic
997568111 5:134905018-134905040 CTGCGGGGCTGGCCCGGAGCGGG - Intronic
998643918 5:144041832-144041854 CTGCGGGGCTGGCACGGAGTTGG - Intergenic
999316898 5:150590140-150590162 CTGTGCGGCTGGCGCTTTGATGG - Intergenic
1000159897 5:158587093-158587115 CTATGGTGCTGTGGCTGAGCTGG + Intergenic
1001038697 5:168316451-168316473 TTGTGGGGCTGGCTCCGGGCAGG + Intronic
1001309940 5:170603441-170603463 CTGTGTGGCAGGCCCTGTGCTGG + Intronic
1002165029 5:177338671-177338693 CTGTGGGGCAGGGGCCGTGCTGG - Intronic
1002399135 5:178981503-178981525 CGGTGGGGCTGGCCTTGAGAAGG - Exonic
1002613754 5:180437561-180437583 CTGTGGGCCTGGCGTGGTGCTGG + Intergenic
1003362668 6:5443667-5443689 CTGCGGGGCTGGGGCTCAGCTGG - Intronic
1004202583 6:13563220-13563242 CTGTGGTTAAGGCGCTGAGCTGG + Intergenic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006449021 6:34095332-34095354 GGGTGGGGCTGGAGCTGAGGAGG - Intronic
1006512294 6:34528281-34528303 CTGTGTGCTTGGCGCTGTGCTGG + Intronic
1006579265 6:35067246-35067268 CTGTGGGGCTGGCCCGGGGGTGG - Intronic
1006793196 6:36716823-36716845 CCGTGTGGCAGGCCCTGAGCTGG + Intronic
1007100377 6:39241977-39241999 CTGTGGGGCGGGAGCAGAGGCGG - Intergenic
1007304027 6:40890564-40890586 CAGAGGGGCTTGTGCTGAGCAGG + Intergenic
1007397739 6:41587177-41587199 CTGTGGGGTTGGGGCTGGGAGGG - Intronic
1010244783 6:73653471-73653493 CGGTGCAGCCGGCGCTGAGCTGG - Intronic
1013368824 6:109453783-109453805 CTGTGGAGCTGGCGCTGCTGGGG - Exonic
1013633018 6:112003185-112003207 CTGTGGGGCAGGTGGTAAGCTGG + Intergenic
1015283614 6:131460122-131460144 CTCTGGGGGCGCCGCTGAGCTGG - Intergenic
1015724951 6:136290182-136290204 CTGTGGGGCCGGCTCAGACCAGG + Intergenic
1017053678 6:150419005-150419027 CAGAGGGGCTGGGGCTGCGCTGG - Intergenic
1017433923 6:154397918-154397940 CTGTGGCGCAGGCGCAGAACAGG + Exonic
1018343664 6:162879681-162879703 CTGTGGGCCAGGCCCCGAGCTGG + Intronic
1018755871 6:166849436-166849458 CTGTGTGTCTGGCCCTGTGCTGG - Intronic
1018992548 6:168685080-168685102 CTGTGTAGCAGGCACTGAGCTGG + Intergenic
1019164340 6:170088241-170088263 CTGTGGGGCTGGGAGTGAGCGGG + Intergenic
1019416892 7:931985-932007 CTGTGGGGCGGGAGCTGCACTGG - Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019529227 7:1495300-1495322 GTGTGGGGCAGGGGCTGTGCGGG + Intronic
1019576775 7:1741386-1741408 CTCTGGGGCAGGGGCCGAGCAGG + Intronic
1019590682 7:1829213-1829235 CTGAAGGGCTGGCGCTGATGCGG - Intronic
1019738744 7:2662662-2662684 CTGAGGGGCTGGACCCGAGCCGG + Exonic
1019750875 7:2728895-2728917 CGGTGGGGTCAGCGCTGAGCGGG + Exonic
1021390741 7:20089599-20089621 CTATGGGGCTGAAGCTGAGATGG + Intergenic
1022124438 7:27341874-27341896 CTGTGGAGCTGTCAATGAGCTGG + Intergenic
1023965313 7:44960964-44960986 CTGAGGGGCTGGGGCTGAGGGGG + Intergenic
1023980737 7:45068626-45068648 GGGTGGGGCTGGCCATGAGCAGG - Intronic
1024069737 7:45775650-45775672 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
1024902848 7:54341509-54341531 ACGTGGGGCTGGCCCTTAGCAGG + Intergenic
1025099651 7:56124003-56124025 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1025829893 7:65039030-65039052 CTTTGGGGCCGGCGCGGAGACGG + Intergenic
1027320020 7:77005297-77005319 GGCTGGGGCTGGCGCTGGGCAGG + Intergenic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1030250453 7:107438286-107438308 CTCTGGTGCTGCCTCTGAGCTGG - Intronic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1032047126 7:128619935-128619957 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
1032079160 7:128850047-128850069 GTGTGGGGCGGGCGCCGGGCCGG - Exonic
1032336508 7:131029713-131029735 CTGAGGACCTGGCGCAGAGCGGG + Intergenic
1032843594 7:135734160-135734182 TGGAGAGGCTGGCGCTGAGCCGG + Exonic
1033134617 7:138774089-138774111 AGGTGGGGCGGGGGCTGAGCAGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034460503 7:151195547-151195569 ATGAGGGGCTGGGGCTGGGCAGG - Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1035257239 7:157638645-157638667 CCGTGTGACTGGCACTGAGCTGG - Intronic
1035436479 7:158863702-158863724 GTGTGGGGGGGGCGGTGAGCGGG + Intronic
1035882517 8:3257740-3257762 TTCTGGGGCTGGAGCTGAGAAGG + Intronic
1036791131 8:11721008-11721030 CTGTGAGCCTGGCGCTGGTCAGG + Intronic
1037588541 8:20294683-20294705 CTTTGGGGGTGGCGGGGAGCAGG + Intronic
1038033287 8:23663374-23663396 CTCTGGGGCTGCTGCTGAGAAGG + Intergenic
1038049306 8:23794125-23794147 CTGTGAGGCTGGCGTTGGTCTGG + Intergenic
1038446850 8:27610527-27610549 TTGTGGGGCTGCTGCTGACCTGG - Exonic
1038963647 8:32548587-32548609 CTGAGGCGCTCGCGCTGCGCGGG - Intronic
1039868981 8:41529434-41529456 CTGTGTGGGTGGCACTGAGAGGG + Intronic
1042793697 8:72636936-72636958 CTGTGGGGCTGCCTCTGATTTGG - Intronic
1045363534 8:101454528-101454550 CTTTGTGCCTGGCACTGAGCAGG + Intergenic
1047100150 8:121667507-121667529 CTGGGAGGCTGGGGCTGCGCAGG + Intergenic
1049014235 8:139908271-139908293 TGGTGCTGCTGGCGCTGAGCTGG + Intronic
1049159721 8:141089492-141089514 CTGTGGGGTTGGCATGGAGCTGG + Intergenic
1049268660 8:141682776-141682798 TTCTGAGGCTGGTGCTGAGCTGG + Intergenic
1049389618 8:142361023-142361045 CTGAGGGGCTGGAGCTGTTCTGG - Intronic
1049469631 8:142769557-142769579 GTCGGGGGCTGGGGCTGAGCTGG + Intronic
1049684229 8:143932897-143932919 CCGTGTGGATGGCGCTGAGTGGG - Exonic
1049732295 8:144184912-144184934 CTATGGGGCTGGGGCAGAGCAGG + Intronic
1049808610 8:144553012-144553034 CTGTGGGGCTGGCATGGGGCTGG + Intronic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1051780580 9:20684400-20684422 CTGCGGGGCTGGGGCTGAGCTGG + Intronic
1052827484 9:33187549-33187571 CAGTGTGGCTGGCGCAGAGGAGG - Intergenic
1056753003 9:89365163-89365185 CTCTGGGGCTGGAGCTTAGTGGG - Intronic
1056787802 9:89605297-89605319 CCGGGGTGCAGGCGCTGAGCCGG + Intronic
1057268110 9:93632004-93632026 GTGTGGTGCTGGGGCTGGGCAGG + Intronic
1057716733 9:97501769-97501791 CTGTGGGGCCGGCGCGGACGCGG - Exonic
1057904693 9:98974727-98974749 CTGGGGGGCCGGGGCTGAGGGGG - Intronic
1058316457 9:103573350-103573372 CTGTGTGCTTGGTGCTGAGCAGG - Intergenic
1058553158 9:106137192-106137214 CTGTGTGGCTGGACCTGACCTGG + Intergenic
1058958854 9:109973932-109973954 CTATGTGCCTGGCGCTGTGCTGG + Intronic
1059104661 9:111501252-111501274 CTGTGGAGCTGGCTGGGAGCAGG + Intergenic
1059386775 9:113970902-113970924 CTGTGGGCCTGGCCCCTAGCAGG + Intronic
1059456889 9:114405556-114405578 CTCTAGAGCTGGCACTGAGCTGG - Intronic
1060002337 9:119969792-119969814 CTGTGAGCCTGGCCCTGTGCCGG - Intergenic
1060152182 9:121295768-121295790 CTGTGTGCCTGGAGCTGGGCAGG + Intronic
1060246898 9:121954063-121954085 CAGTGGGGCTGGGGCTGTGTTGG - Intronic
1060478029 9:123999941-123999963 CTGCGGGGCCGGCCCGGAGCCGG - Intergenic
1060521642 9:124297457-124297479 CAGTGAGGCTGGCGGGGAGCTGG - Intronic
1060546248 9:124462171-124462193 TTGAGGGGCTGGGGCTGAGGTGG - Intronic
1060944283 9:127560696-127560718 CTGTGTGCCCGGCGCTGTGCTGG - Intronic
1061402834 9:130377850-130377872 TTGTGGGGCTGGCCCTCCGCAGG + Intronic
1061549251 9:131323857-131323879 CTGTGGGGCTGGGCATGCGCAGG - Intergenic
1061852175 9:133422649-133422671 CTTTGGGGTTTGCGCTGGGCAGG + Intronic
1061856699 9:133445454-133445476 CTGTGGGCCTGGCCGAGAGCTGG - Intronic
1061986910 9:134135420-134135442 CCGCGGGGCTGGCGGGGAGCAGG + Intronic
1062086922 9:134653808-134653830 CTGTAGGGCTGGGGGTGTGCAGG + Intronic
1062218785 9:135403381-135403403 CTGCAGGCCTGGGGCTGAGCCGG - Intergenic
1062673029 9:137722934-137722956 CTGTGGTTCTGGGCCTGAGCCGG + Intronic
1062673055 9:137723045-137723067 CTGTGGTTCTGGGCCTGAGCCGG + Intronic
1062733657 9:138122522-138122544 CTGTGGGGCTGACGGTGTCCAGG - Exonic
1062749979 9:138245684-138245706 CTGAGGGGACGGGGCTGAGCTGG - Intergenic
1186461500 X:9751968-9751990 CTCTGGGGCTGGCCCCCAGCAGG - Intronic
1187826289 X:23335272-23335294 CGGTCGGGCTGGCTCTGCGCTGG + Intronic
1190726852 X:53195467-53195489 CTCTGTGCCTGGCCCTGAGCTGG + Intronic
1192175270 X:68881179-68881201 CTATAGGGCTGGGGCTGAGGGGG + Intergenic
1197615290 X:128683756-128683778 CTGTGTGGGTGGGGCTGAGGGGG - Intergenic
1200047677 X:153411369-153411391 CTGTGGGGCGGGCGCGGGGCGGG + Intergenic