ID: 1103447078

View in Genome Browser
Species Human (GRCh38)
Location 12:121001447-121001469
Sequence AGGGACTGTCGCTGCTTCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103447074_1103447078 -2 Left 1103447074 12:121001426-121001448 CCTGTTCATGGCAGATGTAGGAG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1103447078 12:121001447-121001469 AGGGACTGTCGCTGCTTCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103447078 Original CRISPR AGGGACTGTCGCTGCTTCGT GGG Exonic
900616815 1:3569207-3569229 AGAGGCTGTCCCTGCTTCTTTGG - Intronic
902733967 1:18387898-18387920 AGGGACTTTCTCTGGTTGGTTGG - Intergenic
905873022 1:41415799-41415821 AGGGACAGTATCTGCTTCATAGG - Intergenic
908510813 1:64848783-64848805 AGGGACTGTCACTGATACCTAGG + Intronic
911129907 1:94377232-94377254 AGGGACTGTTGCGGGTTCTTGGG - Intergenic
912710379 1:111945488-111945510 AGTGACAGTGCCTGCTTCGTGGG - Intronic
915394255 1:155570267-155570289 AGGGACTATGACTGCTTCTTAGG - Intergenic
916437138 1:164787677-164787699 AGGGACTGTCACAGCATTGTGGG - Intronic
916939387 1:169663597-169663619 AGGGACTGTTGCGGGTTCTTGGG + Intronic
916939399 1:169663677-169663699 AGGGACTGTTGCAGGTTCTTGGG + Intronic
922718713 1:227889593-227889615 AGCGACTGTCCCTGCTACCTAGG + Intergenic
1064603687 10:17017178-17017200 AGGGACTGTTGCGGGTTCTTGGG - Intronic
1065082290 10:22140465-22140487 AGGGACTGTTGCAGGTTCTTGGG + Intergenic
1071268305 10:83983890-83983912 AGGGACTGCTGTTTCTTCGTGGG - Intergenic
1072371764 10:94771707-94771729 AGGGACTGTTGCAGGTTCCTGGG - Intronic
1074742729 10:116500532-116500554 AGGGACTGTTGCAGGTTCTTGGG + Intergenic
1075082199 10:119391557-119391579 AGGGACTGACGCGGGATCGTGGG + Intronic
1076864474 10:133160216-133160238 AGGGAACGTCGCTCCTTCCTGGG - Intergenic
1079731355 11:23940002-23940024 AGGGACTGTTGCGGGTTCTTGGG - Intergenic
1084210880 11:67621688-67621710 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
1085283712 11:75346660-75346682 TGGGTCTGTCCCTGCTTCTTTGG + Intronic
1085327463 11:75617993-75618015 AGGGAGTGTTGCTCCTTCGGGGG + Intronic
1087074894 11:94119843-94119865 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
1087459113 11:98423418-98423440 AGGGACTGTTGCAGGTTCTTGGG - Intergenic
1089395976 11:118136497-118136519 AGAGACTGCCTCTGCTTCATAGG - Exonic
1089861440 11:121593524-121593546 AGGGACTTTCACTGCCTCCTTGG + Intronic
1090748126 11:129723467-129723489 AGGGACAGTGGCTTCTCCGTGGG - Intergenic
1091980093 12:4857768-4857790 AGAGACTGTCCCTGTTTCCTTGG - Intergenic
1092472176 12:8789852-8789874 TGGGACTGTTGCTGGTTCTTGGG + Intergenic
1094320078 12:29173767-29173789 AGGGACTGTCGCGGGTTCTTGGG - Intronic
1094338227 12:29384178-29384200 AGGGACTGTTGCGGGTTCTTGGG - Intergenic
1100209679 12:92388235-92388257 AGGGACTGTCGTAGGTTCTTGGG + Intergenic
1103447078 12:121001447-121001469 AGGGACTGTCGCTGCTTCGTGGG + Exonic
1109500931 13:63235531-63235553 AGGGACTGTTGCAGGTTCTTGGG + Intergenic
1112519007 13:100079931-100079953 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
1119794471 14:77383188-77383210 AAGGACTATGGCTGCTCCGTAGG - Intronic
1125925408 15:43558991-43559013 AGGGACTCTCCATGCTTCCTTGG - Intronic
1125938555 15:43658545-43658567 AGGGACTCTCCCTGCTTCCTTGG - Intronic
1132002752 15:98196606-98196628 AGGGGCTGTTTCTGCTTAGTCGG + Intergenic
1140861721 16:79024282-79024304 AGGGCCTTACGCTGCTGCGTAGG + Intronic
1144888095 17:18477579-18477601 AGGGACTGTCCCTGCAGTGTGGG + Intronic
1145144110 17:20466724-20466746 AGGGACTGTCCCTGCAGTGTGGG - Intronic
1145218159 17:21067651-21067673 AGGGGCAGTCACTGCTTAGTGGG + Intergenic
1146947737 17:36885181-36885203 AGGGCCTGACGCTGCTTCTCTGG + Intergenic
1147266244 17:39236646-39236668 AGGGCCTCTGGCTGCTTCTTTGG + Intergenic
1155259300 18:24025902-24025924 AGGGAGTGTCTCTGTTGCGTTGG + Intronic
1160017313 18:75154631-75154653 AGGGACTGTGCATGCATCGTCGG + Intergenic
1161598345 19:5164279-5164301 AGGGACTGTTGCAGGTTCTTGGG - Intronic
1163714819 19:18867548-18867570 AGGGACTGTCGGTACCTCCTGGG - Exonic
1164672804 19:30082520-30082542 AGGGACTGTCCCTGGTTCTCTGG + Intergenic
1164993089 19:32698608-32698630 AGGGACTGTTGCGGGTTCTTGGG - Intronic
1165466268 19:35976884-35976906 TGGGCCTGTGGCTGCTTGGTGGG + Intergenic
1165846964 19:38824367-38824389 AGGGACTGTTGCAGTTTCTTGGG + Intronic
925950008 2:8901059-8901081 AGGGACTGTTGCAGGTTCTTGGG - Intronic
925950033 2:8901218-8901240 AGGGACTGTTGCAGGTTCTTGGG - Intronic
928946740 2:36778599-36778621 TGGGACTGTCGACGCTTTGTTGG + Intronic
929330240 2:40673648-40673670 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
932688703 2:73894529-73894551 AGGCACTGTCTCTGCTCCTTAGG + Intronic
935735047 2:106099857-106099879 TGGGACTGTTGCTGATTCATGGG - Intronic
937991015 2:127662384-127662406 AGGGACTGGAGCTGCTCCCTGGG - Intronic
939851725 2:147312950-147312972 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
941243287 2:163068328-163068350 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
1172644302 20:36460657-36460679 AGGTCCTGTCGCTGCCTTGTGGG - Intronic
1172941582 20:38658116-38658138 AGGGGCTCTCTCTGCTTCATGGG - Intergenic
1174093805 20:48071213-48071235 AGGGACTGACTCTGCTTCTTTGG + Intergenic
1185095606 22:48804505-48804527 AGGGACTGTGGCCGCATCCTCGG + Intronic
952555179 3:34522734-34522756 AGGGACTGTTGCAGGTTCTTGGG - Intergenic
953960538 3:47262709-47262731 AGGGACTGTCCCAGCTTCCAAGG - Intronic
954586849 3:51743887-51743909 AGGGACCGTTGCTGGTTCTTGGG + Intergenic
954598796 3:51851813-51851835 AGGGACTGTTGCAGGTTCTTGGG + Intergenic
963021132 3:140873996-140874018 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
963173057 3:142270793-142270815 AGGGACTGGCTCTTCTTCCTGGG + Intergenic
964056913 3:152472410-152472432 AGGTACTGTCGCTGCTCTGGTGG + Intergenic
964064371 3:152561467-152561489 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
966932669 3:184685937-184685959 AGAGAATGTCGCTGTTTCTTAGG + Intergenic
968974921 4:3817046-3817068 AGGAACTGTGGCTGCTGCCTGGG - Intergenic
973584247 4:52375260-52375282 AGGGCCTGCTGCTGCTTCCTGGG - Intergenic
975047867 4:69826498-69826520 AGGGACTGTTGCGGGTTCTTGGG + Intronic
977883966 4:102236965-102236987 AGGGACTGTCACGGGTTCTTGGG + Intergenic
988605643 5:32676406-32676428 AGGGACTGTTGCAGGTTCTTGGG - Intergenic
1001434969 5:171693180-171693202 AGTAACTGTCTCTACTTCGTAGG + Intergenic
1001798316 5:174520488-174520510 AGGGACTGTCACTTCTCAGTGGG - Intergenic
1003463404 6:6353280-6353302 ATGGACTGCCGCTGCTGCCTGGG - Intergenic
1005064866 6:21808126-21808148 AGGGTTTGTCTCTGCTTCCTGGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1008587139 6:52960388-52960410 AGGGACTGTCACGGGTTCTTGGG - Intergenic
1019341340 7:510449-510471 AGGGACCCTGGCTGCTTGGTAGG + Intronic
1019341422 7:510664-510686 AGGGACCCTGGCTGCTTGGTAGG + Intronic
1019436968 7:1027540-1027562 AGGCTCTGCCGCTGCTGCGTCGG - Intronic
1021356746 7:19659523-19659545 AGGGACCGTCGCGGGTTCTTGGG - Intergenic
1022883327 7:34613658-34613680 AGGGACAGTTTCTGCTTCTTTGG - Intergenic
1031731619 7:125309407-125309429 AGGGACTGTTGCAGGTTCTTGGG + Intergenic
1031731630 7:125309487-125309509 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
1035105150 7:156435723-156435745 AGGGACTGCTGCTCCTTAGTGGG - Intergenic
1039693325 8:39883830-39883852 AGGGACTGTTGCAGGTTCTTGGG - Intergenic
1040953241 8:52956300-52956322 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
1047251658 8:123185606-123185628 ATGGAGTTTGGCTGCTTCGTTGG + Intronic
1053666875 9:40323202-40323224 AGAGACTGTCCCTGCTGTGTGGG + Intronic
1053916467 9:42948309-42948331 AGAGACTGTCCCTGCTGTGTGGG + Intergenic
1054378027 9:64463230-64463252 AGAGACTGTCCCTGCTGTGTGGG + Intergenic
1054517734 9:66053081-66053103 AGAGACTGTCCCTGCTGTGTGGG - Intergenic
1055436463 9:76296794-76296816 AAGGACTGCAGCTGCTGCGTGGG + Exonic
1057000605 9:91505233-91505255 AGGGACTGATCCTGCTTCTTTGG + Intergenic
1188136367 X:26499130-26499152 AGGGACTGTTGCAGGTTCTTGGG + Intergenic
1188214796 X:27463168-27463190 AGGGCATGTCGCTGCTTGTTCGG - Intergenic
1190541300 X:51481287-51481309 AGGGACTGTTGCGGGTTCTTGGG + Intergenic
1195439419 X:104884413-104884435 AGGGACTGTTGCAGGTTCTTGGG + Intronic
1196488833 X:116245160-116245182 AGGGACTGTTGCAGGTTCTTGGG + Intergenic
1197798954 X:130328910-130328932 AGGGACTGTTTCTGGTTCGCTGG + Intergenic
1201454982 Y:14159899-14159921 AGGGACTGTTGCAGGTTCTTGGG + Intergenic
1201631109 Y:16072836-16072858 AGGGACTGTTGCAGGTTCTTGGG + Intergenic