ID: 1103447782

View in Genome Browser
Species Human (GRCh38)
Location 12:121005491-121005513
Sequence GGAGCCAGTGGAGGGCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103447776_1103447782 1 Left 1103447776 12:121005467-121005489 CCAAGGGTCATGCTGATGCCTGA 0: 1
1: 0
2: 2
3: 8
4: 128
Right 1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG 0: 1
1: 0
2: 2
3: 20
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103447782 Original CRISPR GGAGCCAGTGGAGGGCGCGC TGG Intronic
900164549 1:1239531-1239553 GGAGCCAGGGGAGGCAGGGCTGG - Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900630991 1:3635134-3635156 GGAACCAGTGCAGGGCACTCAGG - Intronic
901434708 1:9240067-9240089 GGAGACAGTGAAGGGTGCCCAGG + Intronic
901868847 1:12125779-12125801 GGAGCCAGGCGAGGGAGGGCTGG + Intronic
902623320 1:17662876-17662898 GGACCCAGTGGAGGGCAGGTGGG + Intronic
903419819 1:23210620-23210642 GGAGCCAGTAGAAGGAGCGCTGG - Intergenic
904306757 1:29594855-29594877 GGGGGCAGGGGAGGGCGCCCTGG + Intergenic
904724855 1:32539589-32539611 GGCGCCGGCGGAGGGCGGGCGGG + Intronic
904900919 1:33856385-33856407 GGAGCCAGTGGAGGCCAGGCTGG - Intronic
905182264 1:36174834-36174856 GGAGCCAGTGGGGGGCACCGAGG - Intronic
905340396 1:37273914-37273936 GGAGCTAGTGGTGGGGGCGGGGG - Intergenic
906290620 1:44617325-44617347 GAAGCGAGGGGAGGGGGCGCGGG - Intronic
906377043 1:45304116-45304138 GACGCCACTGGAGGGCGCGCGGG - Intronic
908131860 1:61082428-61082450 GGAGGCGGAGGCGGGCGCGCGGG + Intronic
908781670 1:67696623-67696645 GGAGCCAGAGGAGGGCACGTGGG - Intergenic
912435662 1:109659371-109659393 AGAGCCAGTGGAGGCTGTGCTGG + Intronic
912437556 1:109672476-109672498 AGAGCCAGTGGAGGCTGTGCTGG + Intronic
912443399 1:109715502-109715524 AGAGCCAGTGGAGGCTGTGCTGG + Intronic
915969469 1:160343537-160343559 GGAGACAGTGGCGGTCGCGGCGG - Intronic
916048789 1:161020658-161020680 GGTGCGTGTGGAGCGCGCGCTGG + Intronic
921079227 1:211725414-211725436 GGAGCCAGTGGAGAGAGAGGAGG - Intergenic
921726738 1:218532845-218532867 GGAGCCAGGGCCGGGCGCGGTGG - Intergenic
922418266 1:225441696-225441718 AGAGCCAGTAGAGGGAGCTCAGG - Intergenic
1064022792 10:11823319-11823341 GGCGGCAGTAGAGCGCGCGCGGG + Intronic
1067225935 10:44375598-44375620 AGAGGAAGTGGAGGGCGGGCTGG + Intronic
1068954914 10:62813766-62813788 GGGGCCAGTGGAGGCAGCGAGGG - Exonic
1072267660 10:93745913-93745935 GGGGCCTGTGGAGGGCAGGCGGG - Intergenic
1072605549 10:96979078-96979100 GAAGCCAGTGGAGGGTGGGAAGG + Intronic
1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG + Intronic
1075724815 10:124605833-124605855 AGAGCCAGTGGAGGGGGAGGGGG + Intronic
1076495896 10:130897847-130897869 AGAGCCAGAGGAGGGCACGTGGG - Intergenic
1076683101 10:132185495-132185517 GGCGAGTGTGGAGGGCGCGCGGG - Intergenic
1076688302 10:132208066-132208088 GGAGCCTGTGGAGGACGAGGCGG - Exonic
1076778203 10:132709681-132709703 GGAGCCTGTGGAGGACACGCAGG + Intronic
1077138850 11:1014698-1014720 GCAGCCAGGGGAGGGCACACGGG - Intronic
1077200313 11:1303621-1303643 GGTGCCAGGGCAGGGCCCGCAGG + Intronic
1077533987 11:3110295-3110317 GCAGCCACTGGAGGGCGAGGTGG + Intronic
1078679631 11:13463364-13463386 GAAGGCAGTTGAGGGCGCGGCGG + Intergenic
1079010773 11:16826394-16826416 GGACCCACTGGAGGGCAAGCGGG - Exonic
1079519884 11:21314005-21314027 GGAGCAAGTGGGGGTCGCGGGGG - Intronic
1079642981 11:22829849-22829871 CGAGCCAGTGGAGGGCGGTGGGG - Exonic
1082789232 11:57335760-57335782 GGCGCGAGAGGTGGGCGCGCTGG + Exonic
1082816809 11:57514761-57514783 GGAGTGAGTGAGGGGCGCGCGGG - Intronic
1082833767 11:57638183-57638205 GAAGCCAGGGGAGGGGGCTCCGG + Intergenic
1083265435 11:61544700-61544722 GGAGCCAGTGGATGGCATGGAGG + Intronic
1083775934 11:64894352-64894374 AGAGCCAGGGGAAGGCGTGCAGG + Intergenic
1083776680 11:64897555-64897577 GGAGCCACTGGAGAGCGCCCTGG + Intronic
1083901496 11:65645651-65645673 GGAGCCTGTGGAGGGAGAGGAGG + Intronic
1083920993 11:65781297-65781319 GGCGCCGGCGGGGGGCGCGCTGG - Intergenic
1084568302 11:69943987-69944009 GGAGCCAGGGGAGGGCCCTCTGG + Intergenic
1084568504 11:69945080-69945102 GGAGCCAGGGGAGGGCCCTCTGG - Intergenic
1086341864 11:85855295-85855317 GGAGCCCGTGGAGGGTGGTCGGG - Exonic
1088638659 11:111849630-111849652 GGGGCCTGTGGAGGGGGCGGAGG - Intronic
1088871188 11:113891847-113891869 GGACCCAGGGGCGGGCGCGGTGG - Intergenic
1089489206 11:118871376-118871398 GGAGCCAGTGGAGGGTGGGGTGG - Intergenic
1089640245 11:119843199-119843221 GGAGCCAGGAGAGGGAGAGCAGG + Intergenic
1089855924 11:121544800-121544822 GAAGGCAATGGAGGGCTCGCTGG - Intronic
1090377860 11:126304036-126304058 GGGGCCAGCGCAGGGGGCGCAGG + Exonic
1090441472 11:126728612-126728634 GGGGCCAGTGTAGGGCCCACAGG + Intronic
1090662340 11:128891153-128891175 GGAGCCGGGGGAGGGCGCAGGGG + Intergenic
1091270770 11:134310380-134310402 GAAGCCAGTGGAAGGTGCCCAGG + Intronic
1092155329 12:6278602-6278624 GGAGCGACGGGAGGGCCCGCGGG + Intergenic
1092894877 12:13001427-13001449 GGAGCCTGTGGCGGCCGCGGGGG + Intergenic
1096122680 12:49098330-49098352 GGAGCCAGAGGAGGCCTCACTGG - Intronic
1097184368 12:57188739-57188761 GGACCCAGTGGGGAGCGCGAGGG + Intronic
1097619421 12:61922436-61922458 GCAGCCTATGGAGGGCGAGCAGG + Intronic
1102444704 12:112992925-112992947 GAACCCAGTAGAGGGCGCTCTGG - Intronic
1102519810 12:113471266-113471288 CGCCCCAGTGGAGCGCGCGCAGG + Intronic
1102601821 12:114037225-114037247 GGAGCGAGGGGAGGGCGGGATGG - Intergenic
1103363680 12:120368385-120368407 GGCGGCAGTGGAGAACGCGCGGG - Intronic
1103400696 12:120641060-120641082 GCCGCGAGAGGAGGGCGCGCGGG + Exonic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG + Exonic
1103954301 12:124567724-124567746 GGAGCCAGAGGGGGCCGGGCCGG - Intergenic
1105540039 13:21308371-21308393 GGAGCCAGGGGTGGGTGGGCTGG + Intergenic
1105602566 13:21900402-21900424 GGAGCCAAGGGAGGGAGCCCTGG - Intergenic
1106635799 13:31527372-31527394 GGGGCCAGAGGAGGGAGGGCAGG - Intergenic
1107324263 13:39224105-39224127 GGAGCCTGTCGAGGGGGCGGGGG + Intergenic
1107407633 13:40129349-40129371 GTTGCCAGTGGAGGGTGCCCAGG + Intergenic
1109302238 13:60601136-60601158 GGAGGCAGTGGAGGCAGCGGAGG - Intergenic
1112578995 13:100662374-100662396 GGAGCAAGTGGATGTCGGGCAGG - Intronic
1113455192 13:110443761-110443783 GGACCCAGTGGAGGCTCCGCCGG - Intronic
1114364444 14:22012008-22012030 GGCGCCAGTGGTGGGGGCCCAGG + Intergenic
1114527378 14:23375362-23375384 GGAGGCAGGGGAGGGTGAGCAGG - Intronic
1115768535 14:36647508-36647530 GGCCCCAGTCGAGGGCGCGCAGG - Intergenic
1121113320 14:91327380-91327402 GCAGCGAGAGGAGGGCACGCAGG - Intronic
1121454107 14:94027408-94027430 GGAGCCTGTGGAGTGAGGGCTGG + Intronic
1122967376 14:105137709-105137731 GGAGCCACGGGAGGGCTTGCTGG - Intergenic
1123134124 14:106011819-106011841 AGAGCCAGCAGGGGGCGCGCGGG - Intergenic
1123709917 15:22980040-22980062 GAAGCCAGTGCAGGGAGTGCGGG + Intronic
1124477027 15:30044555-30044577 TGAGCCCGGGGAGGGCGGGCCGG + Intergenic
1125453333 15:39831796-39831818 GGAGCCAGTGGAGGATACGGAGG - Intronic
1125535799 15:40440841-40440863 GGAGCCAGCGCAGGGCGGGGCGG + Intronic
1125599229 15:40906550-40906572 GGAGCCAGGGTAGGGAGCGGTGG - Intergenic
1125722510 15:41852066-41852088 GGAGCCAGTGCTGGGAGCCCGGG - Intronic
1126538997 15:49801631-49801653 GAAGCCAGTGGAGGGTGAGAGGG - Intergenic
1128199454 15:65792214-65792236 GGAGGCAGTGGCGGCCGCGAGGG - Intronic
1128230744 15:66033348-66033370 GGAGCCTGTGGAGGGCACCCTGG - Intronic
1128926719 15:71662955-71662977 GGAGTCAGTGAGGGGCGGGCAGG + Intronic
1129503325 15:76060174-76060196 GGAGCCAGGCGAGGGTGCGTGGG + Intronic
1129606092 15:77025691-77025713 AGAGCCAGTGGAGGGCGGCAGGG + Intronic
1129693859 15:77729483-77729505 GGAGCTGGTGGAGGGAGAGCAGG + Intronic
1129934296 15:79436866-79436888 GGGGACAGTGGAGGGCTCACTGG - Intronic
1129997173 15:80016754-80016776 GGAGCCCACGGAGGGCGGGCAGG - Intergenic
1130656448 15:85794818-85794840 GGAGCCTGTTGAGCTCGCGCGGG - Exonic
1132128430 15:99251439-99251461 GGAGCCAGGCGAGGGCGGGGCGG - Exonic
1132478633 16:154556-154578 GGAGCGGGAGGAGGGCGCCCCGG + Intronic
1132610498 16:813651-813673 GGAGCCCGGGGAGGCCGCCCAGG + Exonic
1132929890 16:2453704-2453726 GGAGACAGTGGAGGTTACGCAGG - Intronic
1133234595 16:4382046-4382068 TGGGGCAGTGGAGGGCGGGCTGG - Exonic
1136364962 16:29805777-29805799 GGCGCAGGTGGTGGGCGCGCGGG - Intergenic
1136398876 16:30007130-30007152 GGCGCCAGGGGAGGGGGCCCTGG - Intronic
1136776740 16:32875825-32875847 GGAGCCTGTGAAGGGGGAGCAGG - Intergenic
1136893877 16:33985688-33985710 GGAGCCTGTGAAGGGGGAGCAGG + Intergenic
1138345151 16:56316115-56316137 GGAGCTAGTGGAGGCCTGGCAGG - Intronic
1138630831 16:58293156-58293178 GGAGGCAGGGCAGGGCGGGCTGG + Intronic
1138660725 16:58515635-58515657 GGAGGGAGCGGAGGGGGCGCAGG - Intronic
1141430412 16:83968196-83968218 GGAGCCGGCAGAGGGCGCTCCGG + Intergenic
1141594143 16:85087215-85087237 GGAGCCAGTGCTGTGCCCGCTGG + Intronic
1141702314 16:85648226-85648248 GGAGCCTGGGCAGGGCGGGCAGG - Intronic
1141959157 16:87392721-87392743 GCAGCCGGCGGAGGGCGGGCGGG + Intronic
1142320860 16:89382060-89382082 GGAGCCAGTGAATGGGGCCCAGG + Intronic
1142395260 16:89828343-89828365 GCGGGGAGTGGAGGGCGCGCGGG - Intronic
1203079155 16_KI270728v1_random:1137934-1137956 GGAGCCTGTGAAGGGGGAGCAGG - Intergenic
1143015796 17:3890547-3890569 GGAGACAGAGGAGGACGAGCAGG - Intronic
1143323161 17:6080943-6080965 GGAGCCAGCGGGGGCCGGGCCGG - Exonic
1144144213 17:12381701-12381723 GGAGCTGGAGGAAGGCGCGCAGG + Intergenic
1144764085 17:17723624-17723646 GGAGCGGGAGGAGGGGGCGCCGG - Intronic
1144786805 17:17836666-17836688 GGCGCGAGTAGGGGGCGCGCAGG - Intronic
1145255073 17:21317962-21317984 GGAGGCAGGGGTGGGCGCCCGGG - Intergenic
1147948859 17:44095891-44095913 GAAGGCAGTGGAGGGCCTGCTGG + Intronic
1148209788 17:45801173-45801195 GGAGCCTGTGGAGGGGGTGGAGG - Intronic
1150267779 17:63842325-63842347 GGAGACGGTGGAGGGCGGGCCGG - Intronic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1152637672 17:81436773-81436795 GGAACCTGGGGAGGGCGCCCTGG - Intronic
1152686135 17:81694677-81694699 GGAACCAGAGGAGGGCACGGAGG + Intronic
1153051981 18:908405-908427 GGTGCCTGTGCGGGGCGCGCGGG + Intronic
1153565445 18:6414182-6414204 GGAGCCCAGGGAGTGCGCGCAGG - Intronic
1159965295 18:74589137-74589159 GGAGCCAGTGCAGGGCTCCCGGG - Intergenic
1160130233 18:76218855-76218877 GGCGCCAATGGAGGGAGGGCAGG - Intergenic
1160726794 19:620976-620998 GGCGCCGGGGGAGGGCGCGGGGG + Intronic
1160726805 19:620997-621019 GGCGCCGGGGGAGGGCGCGGGGG + Intronic
1161375679 19:3937990-3938012 GGGGACAGTGGAGGGGGAGCGGG - Intronic
1161702384 19:5802559-5802581 GGAGGCAGTGGAGGGGCAGCTGG + Intergenic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1162145534 19:8610735-8610757 GTGGCCAGGGGAGGGGGCGCGGG + Intronic
1162573914 19:11487622-11487644 GGAGACAGTGGTGTGCGTGCCGG - Exonic
1163827250 19:19530545-19530567 GGAGGAAGTGGAGGGCGGGAGGG - Intronic
1164728392 19:30482902-30482924 GGACCCAGAGGAGGGCGCTATGG - Intronic
1165060866 19:33204668-33204690 GGAGCCAGTCCAGGGAGCACTGG - Exonic
1165390037 19:35533600-35533622 GGAGGCAGCGGAGGGCGCGGGGG + Intronic
1166518551 19:43464367-43464389 GAAGACAGTGAAGTGCGCGCCGG - Exonic
1166808173 19:45499231-45499253 GGAGCCAGAGGTGGCCGCACTGG + Exonic
1167384972 19:49157806-49157828 AGAGCCGGCGGAGGGAGCGCCGG + Exonic
1167499966 19:49840489-49840511 GGATCCAGTGGGGGGAGGGCGGG + Intergenic
925266938 2:2572073-2572095 GGAGGCAGTGGAGGGGGAGAAGG - Intergenic
925681414 2:6425623-6425645 GGAGCCAGAGGAGGAAGCACAGG - Intergenic
927641313 2:24847493-24847515 GGAGCCAGGGCAGGGCGTACTGG - Intronic
927938018 2:27086281-27086303 AGGGCCAGTGGAGGGAGCGGAGG - Exonic
928314154 2:30232780-30232802 GGAGCCAGAAGAGCGCACGCAGG - Intronic
929200307 2:39228270-39228292 TCAGCCAGCAGAGGGCGCGCCGG - Intronic
932191185 2:69742339-69742361 GGAGCGAGTCCAGGGCCCGCTGG - Intronic
934488414 2:94738697-94738719 GGAGACAGTGGAGAGGGTGCTGG + Intergenic
935275795 2:101474385-101474407 GGAGCGCGCGGGGGGCGCGCGGG + Intronic
935332703 2:101988725-101988747 GGTGCCTGTGGAGGGAGAGCAGG + Intergenic
936093731 2:109516559-109516581 GCCGCCACTGGAGGGCGTGCTGG + Intergenic
936250757 2:110866603-110866625 GGCGCCAGTGGAGGGAGCCAGGG + Intronic
936370586 2:111898932-111898954 GGTGCCAGAGGAGGGGGCGTAGG + Intronic
936405848 2:112201608-112201630 GGAGCCAGGGGAGGTTGGGCAGG + Intergenic
937044966 2:118846470-118846492 GGCGGCAGTGGAGGCGGCGCGGG - Exonic
938614859 2:132987161-132987183 AGAGCCAGTGGAGGACACACAGG - Intronic
938952403 2:136267045-136267067 GCAGCCAATGGAGGGTGAGCAGG - Intergenic
939617781 2:144379956-144379978 GGAGCCAGGGGAGGGGGTGTGGG - Intergenic
940035714 2:149310462-149310484 GGAGGCTGTGGAGGCAGCGCAGG + Intergenic
941416722 2:165230501-165230523 GGACCCAGTGGAGGGTTCTCAGG - Intergenic
942151016 2:173076017-173076039 GGAGCCCGCGGAGGGCGGGGAGG + Intronic
946175275 2:217918751-217918773 GGAGTCCGAGGAGGGCGGGCGGG - Intronic
946329797 2:219002633-219002655 CTGGCCAGTGGAGGGCGCTCCGG - Intergenic
946395554 2:219442165-219442187 GGGCCCGGTGGAGGGGGCGCTGG + Intronic
946401192 2:219469189-219469211 GGAGCCAGAGCAGGGTGAGCTGG + Exonic
947720743 2:232367981-232368003 GGAGGAAGGGGAGGGCTCGCCGG - Intergenic
948048070 2:234958616-234958638 GGAGCCAGTGGAGGAGCAGCTGG + Intronic
948252608 2:236542597-236542619 GTGGCCAGTGGTGGGCGCCCTGG + Intergenic
948988992 2:241542241-241542263 GGAGACAGTGGTGGGCACACTGG - Intergenic
1168753137 20:297785-297807 GGCGGCGGTGGAGGGAGCGCCGG + Exonic
1168766947 20:388232-388254 GGAGCCCGAGGAGGGCGGGCGGG + Exonic
1171485631 20:25483603-25483625 GGAGCAGGTGGAGGCCGCGTGGG + Intronic
1172183427 20:33017113-33017135 GGAGCCAGGGGAGGGGGCTGGGG + Intronic
1172447122 20:34999080-34999102 GGAGGCAGAGGAGGGCGTGGAGG + Exonic
1174526141 20:51173027-51173049 GGAGGCAGTGTAGGGCTGGCAGG + Intergenic
1175889931 20:62311532-62311554 GGAGCCTGTGCAGGGCGGGCAGG + Exonic
1176238437 20:64064943-64064965 GGAGCCAGGGGAGGGCTGGGTGG + Intronic
1179522273 21:41953406-41953428 GGAGCCAGTGGCAGGCGGCCTGG - Exonic
1180699596 22:17774239-17774261 GGAGCCAGAGGAGGGGAGGCGGG - Intronic
1180918675 22:19506984-19507006 GGTCCCAGTGGAGGGCTCTCCGG + Intronic
1180922887 22:19530982-19531004 GGTGCCAGTGGAGGCCACGTGGG + Intergenic
1181311192 22:21945874-21945896 GGAGGAGGTGGAGGGCGAGCTGG - Exonic
1181639168 22:24187836-24187858 GCAGCCAGGTGAGGGCGGGCAGG + Exonic
1182618354 22:31603803-31603825 GGAGCCAGTGGAGGGAGGTAAGG + Exonic
1184236708 22:43186991-43187013 GACGCCGGAGGAGGGCGCGCAGG - Exonic
1184451258 22:44584114-44584136 GGAGCCAGGTGAGGGGGCGGTGG - Intergenic
1184727838 22:46356782-46356804 GGAGCCAGCCGAGGGCAGGCAGG - Intronic
1184735705 22:46396664-46396686 GGAGCCGGGGGAGCGCACGCAGG + Exonic
1184766183 22:46573721-46573743 GGAGCCAGTGGACAGTGCGGGGG + Intergenic
1184894533 22:47399477-47399499 GGGGCCAGTGGAGGGGGCAGTGG - Intergenic
1184918314 22:47588430-47588452 GGAGCCTGAGGAGGGCACCCAGG - Intergenic
1185358907 22:50393311-50393333 GGAGGCAGAGGAGTGAGCGCAGG + Intronic
949533617 3:4979211-4979233 GAAGCCGGGGGAGGGCGGGCAGG + Exonic
950415883 3:12868941-12868963 GGACCCAGTGGAGAGGGCCCGGG + Intronic
950429031 3:12940457-12940479 GGAGCAAGCAGAGGGCGGGCGGG + Intronic
953793576 3:45966555-45966577 GGAGCGAGTGGAGGAGGCACTGG - Exonic
954003996 3:47578247-47578269 GGAGCCAGTGGACGCGGCTCAGG - Intronic
954583965 3:51718642-51718664 GGAGGCTGTGGAGGGCGTGAGGG - Intergenic
956304232 3:67806126-67806148 GAACCCAGTGGAGGGCTCACAGG - Intergenic
960223757 3:115146970-115146992 GGCGCCGGGGGAGGGGGCGCGGG + Intronic
967553809 3:190831456-190831478 GGAGGCGGTGGAGGGGGCCCTGG - Intergenic
968074467 3:195808963-195808985 GGAGCAAGTGCAGGGCAGGCAGG - Intronic
968479489 4:826964-826986 GGGGCCAGGGGAGGGAGCGGTGG - Intergenic
970531348 4:16988639-16988661 GGAGACAGTGGAGGAAGAGCAGG + Intergenic
972314956 4:37917573-37917595 GGAGCCATGGGAGGCCGCACAGG + Intronic
975392194 4:73833394-73833416 GGAGGCAGTGCAGGGCTCACTGG + Intergenic
975683654 4:76898646-76898668 GGACCCCTTGGAGGGGGCGCCGG - Intergenic
977877438 4:102165785-102165807 TGAGCCTTTGGAGGGCGCCCTGG - Intergenic
978487402 4:109271081-109271103 GTAGCCAGTGGAAGGGGCTCAGG - Intronic
986013873 5:3740722-3740744 GAAACCAGGGGAGGGCCCGCGGG - Intergenic
987156729 5:15096598-15096620 GGAGCCCATGGCGGGCGGGCGGG + Intergenic
988707582 5:33740896-33740918 GGAGACAGTGGAGCACGAGCTGG - Intronic
992565852 5:77994696-77994718 GGAGGCAGAGGAGGGCTTGCTGG - Intergenic
992565861 5:77994728-77994750 GGAGGCAGAGGAGGGCTTGCTGG - Intergenic
992565870 5:77994760-77994782 GGAGGCAGAGGAGGGCTTGCTGG - Intergenic
992565879 5:77994792-77994814 GGAGGCAGAGGAGGGCTTGCTGG - Intergenic
992565888 5:77994824-77994846 GGAGGCAGAGGAGGGCTTGCTGG - Intergenic
994190448 5:96863167-96863189 GGAGCCTGAGGAGGGCACACAGG - Intronic
994197461 5:96936049-96936071 GCAGCCCTTGGAGGCCGCGCTGG + Exonic
994648513 5:102498766-102498788 AGAGCCGCTGGAGGCCGCGCGGG - Exonic
999147370 5:149405384-149405406 GGGGCCAGTTGAGGGCCCGAGGG - Intergenic
1002170957 5:177373953-177373975 GGAGCCAGTTGACTGCGCACGGG - Intergenic
1003336197 6:5175370-5175392 AGTGCCAGTGGAGGGCGCTGTGG - Intronic
1005683026 6:28225461-28225483 GGAGCCGGAGGAGGGGGCGGCGG + Intronic
1005947023 6:30602457-30602479 GGCGCCAGAGGAGGTCGCTCTGG - Exonic
1006304525 6:33211306-33211328 CGACCCCGTGGAGGGGGCGCAGG + Exonic
1006513446 6:34533619-34533641 GGAGCCCGTGAAGGCCGCACGGG + Exonic
1006735515 6:36270161-36270183 GAAGCCAGTGGGGGGCTCACAGG + Intronic
1006910969 6:37563414-37563436 GGGGGCAGTGGAGGGCTCTCTGG - Intergenic
1013538767 6:111087615-111087637 GGAGCCCCTGGCGGGCGGGCGGG - Exonic
1016388748 6:143554045-143554067 GGATCCAGTGGCGGGGGCGCTGG + Intronic
1016732206 6:147439033-147439055 GGAGCTAGTGGAGGGCTTGCTGG + Intergenic
1018969953 6:168520451-168520473 TGAGCCAGTGCAGGGCTGGCCGG - Intronic
1019343582 7:519508-519530 GGGGCCGGCGGTGGGCGCGCAGG - Intronic
1019379628 7:714066-714088 GGAGGGAGTGGAGGGGCCGCGGG - Intronic
1019664436 7:2244453-2244475 GGAGGCAGTGGGGGGCGGGGGGG - Intronic
1019743711 7:2688254-2688276 GGAGCCGGCAGAGGCCGCGCCGG - Intronic
1019805539 7:3121313-3121335 GGAGCGGGTGGAGGGAGAGCAGG + Intergenic
1021763262 7:23921870-23921892 GGAGAAAGTGGAGGGCTCGATGG + Intergenic
1021845277 7:24757395-24757417 GGACCCAGCAGCGGGCGCGCGGG - Intronic
1023267061 7:38417824-38417846 GGAGCCAGTGGAGGAGGCAGTGG - Exonic
1025813221 7:64888585-64888607 GGAGAAGGTGGAGGGCGGGCAGG - Intronic
1028684321 7:93575253-93575275 GGAGCCTGTGGAGGGAGGGTCGG + Intergenic
1029121418 7:98270660-98270682 GGAGGCAGTGGAGGGTGGGCTGG + Intronic
1029987056 7:104931781-104931803 GAAAGCAGTGGAGGGAGCGCAGG + Intergenic
1032794117 7:135263803-135263825 GGTGCCAGTGGAGGGTGGGACGG + Intergenic
1033480703 7:141737699-141737721 GGAGCCAGGGAAGGGCTGGCAGG - Intergenic
1034539413 7:151746756-151746778 GGAGCCTGGGGAGAGAGCGCTGG + Intronic
1035249612 7:157588382-157588404 GGAGGCAGGGGAGGGGCCGCGGG - Intronic
1035531396 8:354525-354547 GGAGCCACTGGCGGGAGAGCTGG - Intergenic
1036195294 8:6708547-6708569 GGAGCGGGTGGCGGGCGCGGCGG + Exonic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1037390494 8:18387152-18387174 GGGCCCAGTGCAGGGAGCGCGGG + Intergenic
1037914822 8:22766640-22766662 GGAGCCAGTGGAGGGCATGCTGG + Intronic
1037947746 8:22999770-22999792 GGAGGCAGCGGGCGGCGCGCAGG - Intronic
1038824857 8:30989241-30989263 GGAGCCAGAGGAGGGCACCTTGG + Intergenic
1039589692 8:38736009-38736031 GGAGCCACTGGAGGGAGTACCGG - Intronic
1043388342 8:79768610-79768632 GGAGCCGGGAGAGGGGGCGCCGG + Intergenic
1047961747 8:130016308-130016330 GGATCCAGGGGCGCGCGCGCGGG + Intronic
1049265558 8:141666111-141666133 TGGGCCTGTGGAGGGCGAGCAGG - Intergenic
1049278290 8:141730964-141730986 GGAGTCAGAGGAGGGTGTGCAGG + Intergenic
1049748755 8:144273831-144273853 GGAGCCCCTGGAGGAGGCGCTGG - Intronic
1053198412 9:36136902-36136924 GGTGCGGGTGGAGGGCGCGCGGG + Intronic
1053669374 9:40345668-40345690 GGAGACAGTGGAGAGGGTGCTGG - Intergenic
1053919174 9:42971909-42971931 GGAGACAGTGGAGAGGGTGCTGG - Intergenic
1054380504 9:64485689-64485711 GGAGACAGTGGAGAGGGTGCTGG - Intergenic
1054515242 9:66030623-66030645 GGAGACAGTGGAGAGGGTGCTGG + Intergenic
1056505034 9:87250454-87250476 GGAGCCAGAGGAGGCCAAGCAGG - Intergenic
1057022933 9:91714602-91714624 GGAGCCAGGGGTGGGCGGGGAGG + Intronic
1058686872 9:107487947-107487969 GCTGCAGGTGGAGGGCGCGCTGG + Exonic
1059852905 9:118363925-118363947 GGTGCCAGTGGAGGGTGGGAGGG - Intergenic
1060404429 9:123366209-123366231 GGAACCTGGGGAGGGCGCACCGG - Exonic
1061190751 9:129081280-129081302 CGAGCCCGCGGAGGGGGCGCCGG + Intronic
1061357905 9:130120240-130120262 GGTGCCTGTGTGGGGCGCGCAGG + Intronic
1061561852 9:131409586-131409608 GGAGCCTGTGGGGGCCGGGCTGG + Intronic
1062038457 9:134393128-134393150 GGACCAAGTGCAGGGCGAGCTGG + Intronic
1062230901 9:135480630-135480652 GGAGTCAGGGGAGGTCGGGCCGG + Intronic
1062461790 9:136665468-136665490 GGAGCCAGGAGAGGCCGCCCAGG - Intronic
1062566876 9:137167533-137167555 GGGGGCAGAGGAGGGCGGGCGGG - Intronic
1186524176 X:10233223-10233245 GGAGCCAGTGAAGGGCTCTGAGG - Intronic
1186524198 X:10233339-10233361 AGAGCCAATGGAGGGAGCACTGG - Intronic
1186867403 X:13734379-13734401 TGAGCCAGCGGAGGGCTGGCAGG + Intronic
1187031531 X:15493245-15493267 GGAGCGAGTGCAGGGAGGGCAGG + Exonic
1189324682 X:40105381-40105403 GGGGCCAGCGGAGGCCGCTCGGG - Intronic
1189937076 X:46080580-46080602 GCAGCCCATGGAGGGCGAGCTGG - Intergenic
1190217473 X:48489467-48489489 GGAGCCAGTGGCGGGCGGTGAGG + Intergenic
1195896336 X:109749417-109749439 GGAGCCCATGGAGGGGGCGGAGG + Intergenic
1196814284 X:119652826-119652848 GGAGGCAGGGGCGGGGGCGCTGG - Intronic
1198118332 X:133566294-133566316 GGAGCCAGGGGAGGGAGTGATGG + Intronic
1198184155 X:134237422-134237444 GGAGCCAGGGGCAGGCGCCCAGG + Intronic
1199680298 X:150219868-150219890 GGAGGCAGGGGAGGGCGGCCAGG - Intergenic
1200103117 X:153698207-153698229 GGAGCCTGTGAAGGGGGAGCAGG + Intergenic
1200124680 X:153807694-153807716 GGGGCCAGTGCTGGGCGGGCGGG - Intronic
1200178660 X:154136849-154136871 GGCGCCAGAAGAGGGCGCCCGGG + Intergenic