ID: 1103450838

View in Genome Browser
Species Human (GRCh38)
Location 12:121027682-121027704
Sequence CGAAGGCTTCACCACTGTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103450838_1103450841 20 Left 1103450838 12:121027682-121027704 CCATCACAGTGGTGAAGCCTTCG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1103450841 12:121027725-121027747 TTCTTCAGTACCCATTTCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 204
1103450838_1103450842 29 Left 1103450838 12:121027682-121027704 CCATCACAGTGGTGAAGCCTTCG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1103450842 12:121027734-121027756 ACCCATTTCCCAGGCATAGATGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103450838 Original CRISPR CGAAGGCTTCACCACTGTGA TGG (reversed) Exonic