ID: 1103450838 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:121027682-121027704 |
| Sequence | CGAAGGCTTCACCACTGTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 76 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 69} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1103450838_1103450841 | 20 | Left | 1103450838 | 12:121027682-121027704 | CCATCACAGTGGTGAAGCCTTCG | 0: 1 1: 0 2: 0 3: 6 4: 69 |
||
| Right | 1103450841 | 12:121027725-121027747 | TTCTTCAGTACCCATTTCCCAGG | 0: 1 1: 0 2: 0 3: 19 4: 204 |
||||
| 1103450838_1103450842 | 29 | Left | 1103450838 | 12:121027682-121027704 | CCATCACAGTGGTGAAGCCTTCG | 0: 1 1: 0 2: 0 3: 6 4: 69 |
||
| Right | 1103450842 | 12:121027734-121027756 | ACCCATTTCCCAGGCATAGATGG | 0: 1 1: 0 2: 0 3: 9 4: 139 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1103450838 | Original CRISPR | CGAAGGCTTCACCACTGTGA TGG (reversed) | Exonic | ||