ID: 1103450841

View in Genome Browser
Species Human (GRCh38)
Location 12:121027725-121027747
Sequence TTCTTCAGTACCCATTTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103450840_1103450841 -4 Left 1103450840 12:121027706-121027728 CCAACATGAAATTCTCGTCTTCT 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1103450841 12:121027725-121027747 TTCTTCAGTACCCATTTCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 204
1103450838_1103450841 20 Left 1103450838 12:121027682-121027704 CCATCACAGTGGTGAAGCCTTCG 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1103450841 12:121027725-121027747 TTCTTCAGTACCCATTTCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 204
1103450839_1103450841 3 Left 1103450839 12:121027699-121027721 CCTTCGTCCAACATGAAATTCTC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1103450841 12:121027725-121027747 TTCTTCAGTACCCATTTCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103450841 Original CRISPR TTCTTCAGTACCCATTTCCC AGG Exonic