ID: 1103451560

View in Genome Browser
Species Human (GRCh38)
Location 12:121032843-121032865
Sequence GGCCTGGGTAACCACAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103451560 Original CRISPR GGCCTGGGTAACCACAGAAA GGG (reversed) Intronic
900360139 1:2284366-2284388 GGCCTGGGTCAGCACAGTAGAGG + Intronic
900397232 1:2458097-2458119 GGCCTGGGTGCCCACAGTGACGG - Intronic
901804097 1:11726795-11726817 GGCCGTGGTGACCACAGAGATGG + Intergenic
902939944 1:19793752-19793774 GGCCTGGGTATCCACCCCAATGG - Intronic
904896629 1:33822797-33822819 GACCTGGCTTACCACAGATAAGG - Intronic
904935641 1:34127864-34127886 GGCCTTGGTAACCAAGGAAAGGG + Intronic
906493133 1:46283612-46283634 GGCCTTTGAAACCACAGGAATGG + Intronic
909623343 1:77689059-77689081 GGCTTGGGTGACCACGGAGATGG + Intergenic
909867492 1:80692613-80692635 CACCTTGGAAACCACAGAAAAGG - Intergenic
913280353 1:117179590-117179612 GGCCTGGGTAAACACACAGGGGG + Intronic
913640600 1:120808896-120808918 TTCCTGGGTAAGCACAGAGATGG + Intronic
914211925 1:145587728-145587750 TTCCTGGGTAAGAACAGAAATGG - Intergenic
914364163 1:146963446-146963468 TTCCTGGGTAAGAACAGAAATGG + Intronic
914435578 1:147656425-147656447 GGTCTGAGGAAGCACAGAAAAGG - Intronic
914940820 1:152021521-152021543 TTCCTGGGTAACAACAGAGATGG + Intergenic
915902251 1:159855307-159855329 GGCCTGCGAAACATCAGAAAGGG - Exonic
916712257 1:167422127-167422149 GGCATGGGCAACCATAGGAAGGG - Exonic
917443631 1:175088262-175088284 CTCCTGGGTAGCCTCAGAAAGGG - Intronic
919250792 1:195054262-195054284 GGCCTTGGTCAGCCCAGAAAGGG - Intergenic
920678423 1:208054807-208054829 GGCATGGGGAACCACAGAAATGG - Intronic
921401769 1:214731791-214731813 GTCCTCTGTAACCACAGAAGGGG - Intergenic
921686239 1:218092326-218092348 GGCCTGCGTAACAAAAGAAAAGG - Intergenic
1064007603 10:11710927-11710949 GGCTAGGGTAACCACAAGAATGG + Intergenic
1065034308 10:21621788-21621810 GGCCTGAGTCACGACAGAAGAGG - Intronic
1065598240 10:27339069-27339091 TGCATGGGAAAGCACAGAAAAGG - Intergenic
1065752219 10:28897196-28897218 GGCCTTGGCCAGCACAGAAAGGG + Intergenic
1065870806 10:29954920-29954942 ACCCTGGGTTACCAAAGAAAGGG - Intergenic
1066603252 10:37132085-37132107 TGCATGGGAAAGCACAGAAAAGG + Intronic
1067732435 10:48821678-48821700 TGGCTTGGGAACCACAGAAAAGG - Intronic
1067766638 10:49092051-49092073 GGCCAGGGTAGGCACGGAAAGGG - Intronic
1068093835 10:52465876-52465898 GGCCAGTGTAACCAAAGACAGGG - Intergenic
1070564121 10:77590607-77590629 GGCCTTGGCCACCCCAGAAAGGG + Intronic
1071041152 10:81309506-81309528 GGCCTTGGTCAGCCCAGAAAAGG + Intergenic
1072252602 10:93593525-93593547 GCCAGGGGTGACCACAGAAATGG + Intronic
1073002594 10:100296672-100296694 GGCATGGGTTTCCACAGAACAGG + Intronic
1073785854 10:106889165-106889187 TGCCTGGGGAACCAGAGAAGAGG - Intronic
1074794400 10:116926853-116926875 GGCATGTGGAACCACAAAAAAGG + Intronic
1075330883 10:121573331-121573353 TCCCTGGGAAACCCCAGAAAAGG - Intronic
1076310837 10:129506431-129506453 TGCTTGGAAAACCACAGAAATGG - Intronic
1081290790 11:41322965-41322987 GTCCTGGCTAACCACAAAGAGGG + Intronic
1081691714 11:45082825-45082847 GGCCTGGGGCTCCAGAGAAAGGG - Intergenic
1086062867 11:82718282-82718304 TGCCCGGGCAACCATAGAAAAGG - Intergenic
1088815095 11:113415319-113415341 GGCTTGGGAAACCTCAGCAAGGG - Intronic
1090365186 11:126199631-126199653 GGCCTAAGAAAACACAGAAAAGG + Intergenic
1090775449 11:129961080-129961102 TGCCTGAGAAAACACAGAAAAGG + Exonic
1091862663 12:3800507-3800529 GGGCTGGCTAACATCAGAAATGG + Intronic
1091989179 12:4940896-4940918 GGCCTGGGTAAAAAGAGCAAGGG + Intergenic
1093580205 12:20777831-20777853 GGCCTTGGCCACCCCAGAAAGGG + Intergenic
1093686205 12:22057162-22057184 AGCCTGTATAAACACAGAAATGG + Intronic
1094718247 12:33034351-33034373 GGCCTTGGTCAGCCCAGAAAGGG + Intergenic
1096726585 12:53568507-53568529 GGACTCGGAAACCACAGAAGAGG + Intronic
1096811265 12:54171854-54171876 GGCCCGAGTGACCACAGCAATGG - Intronic
1097021994 12:56027146-56027168 GGAGTGGGTAGCCTCAGAAAGGG + Intronic
1100781697 12:98033655-98033677 GGGCTGGGAAACCACATAATAGG + Intergenic
1101223614 12:102666075-102666097 TGCCTGGGGAACCACGCAAAAGG - Intergenic
1101905487 12:108822082-108822104 AGCCTGGGTGACAAAAGAAAAGG - Intronic
1103451560 12:121032843-121032865 GGCCTGGGTAACCACAGAAAGGG - Intronic
1105654481 13:22420969-22420991 TGCCTGGGAAAGCAAAGAAATGG + Intergenic
1107423878 13:40274449-40274471 GGCATGGGAACCCACAGCAAGGG + Intergenic
1108856576 13:54800098-54800120 GGCCTTGGCCAGCACAGAAAGGG + Intergenic
1108859014 13:54829920-54829942 GGCCTTGGTCAGCCCAGAAAGGG + Intergenic
1109688885 13:65859979-65860001 GGACTTGGAAACCACAGAAAAGG + Intergenic
1110579246 13:77099695-77099717 TCCCTTGGAAACCACAGAAACGG + Intronic
1111602676 13:90494760-90494782 GGCCTTGGCCAGCACAGAAAGGG - Intergenic
1112941020 13:104861733-104861755 GACCTGGGAAACCATAAAAAGGG - Intergenic
1113314310 13:109162376-109162398 GGCCTGGGAAACCACCAAAGAGG - Intronic
1121415663 14:93777726-93777748 GGCCTGAGAGAACACAGAAATGG - Intronic
1121546465 14:94767332-94767354 GGCCTGGGAAACCATACAGAGGG + Intergenic
1124380398 15:29160296-29160318 GGCCTTGGCAAACCCAGAAAGGG + Intronic
1124573070 15:30883697-30883719 GGCCTTGGCCACCCCAGAAAGGG - Intergenic
1130240079 15:82179799-82179821 TGGCTGGGTATGCACAGAAACGG + Intronic
1131867911 15:96731504-96731526 GGACTGGGGAGCCACAGACAGGG - Intergenic
1134147017 16:11773369-11773391 AGCCTGGGTAACCATAGCAAGGG - Intronic
1134257929 16:12626736-12626758 GGGCTGGGTCACCAGTGAAATGG + Intergenic
1134677028 16:16098019-16098041 GGCCTGGGAAATCACAGAGAAGG + Intronic
1136072103 16:27793752-27793774 CTCCTGGGTAGCCAGAGAAAGGG - Intronic
1137519467 16:49179819-49179841 GGCCAGGGTAACAAAAGGAAGGG - Intergenic
1137691759 16:50433148-50433170 GACATGGGTAAACAGAGAAAGGG - Intergenic
1139428081 16:66895558-66895580 GGGCTGGGTGACCACAGGACCGG - Intronic
1141049102 16:80744724-80744746 GGCATGGGTCAACACAGCAAAGG + Intronic
1141389877 16:83655604-83655626 GGCCTGGGAACCCATGGAAAAGG + Intronic
1141598546 16:85111988-85112010 GGACTGGGTCCCCACAGAAGGGG + Intronic
1146517973 17:33504063-33504085 GAACTGGGTAACCAGGGAAATGG + Intronic
1148979971 17:51564437-51564459 GGCAAGTGTCACCACAGAAAAGG + Intergenic
1151804774 17:76398582-76398604 GGACTAGGGAACCAGAGAAAGGG + Exonic
1155072845 18:22331280-22331302 TCCATGGGTAAACACAGAAAAGG + Intergenic
1155561355 18:27080785-27080807 AGCCTGGGTAACCAGGCAAATGG + Intronic
1156932228 18:42659774-42659796 AGCCTGGGTGACAACAGAGAGGG - Intergenic
1158269548 18:55697899-55697921 GGGCTTGGTAACCTAAGAAATGG + Intergenic
1159670263 18:71212897-71212919 GGCCTTGGCCACCCCAGAAAGGG + Intergenic
1160216647 18:76938704-76938726 CGCCTGGGTCACCTCAGAAGAGG - Intronic
1161672824 19:5623600-5623622 GGCCAGGAGAACCACAAAAACGG + Intronic
1162097127 19:8316914-8316936 GGCCTTGGGAGCCTCAGAAAGGG - Intronic
1162440667 19:10690240-10690262 GGCCTGGGTAACCCCAGCCATGG + Exonic
1162864474 19:13534288-13534310 AGACTGGTTAACAACAGAAAAGG + Intronic
1165291188 19:34887640-34887662 GTCCCGGGTGGCCACAGAAAAGG + Intergenic
1166502265 19:43350683-43350705 GTCCTGCGTAACCACAGACCAGG - Intergenic
926857259 2:17270670-17270692 GGCCAGGGTAAACACAGTCATGG + Intergenic
926859280 2:17291766-17291788 GGCCTGGGCAGGCTCAGAAAAGG + Intergenic
928493029 2:31803660-31803682 GGCCTTGGCCAGCACAGAAAGGG - Intergenic
929035644 2:37688874-37688896 GGCCCAAGAAACCACAGAAAAGG - Intronic
929579834 2:43074803-43074825 GGCCTGGGTGCCCAGGGAAAGGG + Intergenic
932614012 2:73220481-73220503 GGCTTGCAAAACCACAGAAAGGG - Intronic
932879998 2:75492282-75492304 GGTAAGGGTAACCACAGAGACGG + Intronic
934898439 2:98138944-98138966 GGCCTTGGTCAGCCCAGAAATGG - Intronic
935709728 2:105887485-105887507 GGCCTGGTGAATCACACAAAGGG + Intronic
936152635 2:110030076-110030098 GGCCAGAGGCACCACAGAAATGG + Intergenic
936192045 2:110341336-110341358 GGCCAGAGGCACCACAGAAATGG - Intergenic
937301186 2:120843363-120843385 TGCCTGGGTAGCCACAGTGATGG - Intronic
938206653 2:129430011-129430033 AGCCTGGGTGAACACAGACATGG - Intergenic
938388764 2:130887761-130887783 AGCCGGGCCAACCACAGAAATGG - Intronic
938758175 2:134399812-134399834 GGCCTGGATGACCAAAGTAAGGG + Intronic
941970658 2:171347365-171347387 GGCCTTGGAAACCGCAGTAAAGG - Intronic
943624422 2:190182187-190182209 GGCCTTGCTAACAACAGAAAAGG - Intronic
943986433 2:194626067-194626089 AGCCAGGGTAATCAAAGAAATGG - Intergenic
947589650 2:231378361-231378383 GCCCTCGGTGATCACAGAAATGG - Intergenic
1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG + Intronic
1171094214 20:22315959-22315981 GAGCTGTGTGACCACAGAAATGG + Intergenic
1171126417 20:22605787-22605809 GTCCTGGGCAGCCACAGAAAAGG - Intergenic
1174276289 20:49407042-49407064 GCCCTGGGTCAGCACAGAGAGGG + Intronic
1174527124 20:51181588-51181610 GGCTTGGGTCAGCACAGAACGGG + Intergenic
1176883327 21:14224727-14224749 GGCCAGGGTGTCAACAGAAAAGG + Intronic
949144424 3:679974-679996 GGCATGGGAAACGAGAGAAATGG + Intergenic
949256666 3:2055696-2055718 GGCTTGGGTGACCTGAGAAAAGG + Intergenic
950096298 3:10332753-10332775 GGCCAGGGTGACCACAGCAAGGG - Intronic
953452390 3:43015735-43015757 GCCATGTGTAGCCACAGAAAGGG + Intronic
956120909 3:65964870-65964892 GGCCTGGACATCCACAAAAAGGG - Intronic
957419726 3:79951790-79951812 GGCCTTGGTCAGCCCAGAAAGGG + Intergenic
959976359 3:112464771-112464793 GGGGTGGGTGACAACAGAAATGG - Exonic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
962696050 3:137948395-137948417 GGGCTGGCTTCCCACAGAAATGG + Intergenic
967117802 3:186357319-186357341 TTCCTGGGAAATCACAGAAAGGG - Intronic
967135928 3:186512642-186512664 GGACTGTGGAAGCACAGAAAAGG + Intergenic
969149979 4:5161026-5161048 GGCCTGGGGATCCACAGTGAAGG + Intronic
969655029 4:8491828-8491850 GGCCTTGGCCAGCACAGAAAGGG + Intronic
970169468 4:13275409-13275431 TGCCTTGGAGACCACAGAAAGGG - Intergenic
971489401 4:27195226-27195248 GGTCTGAGTAACCACAAAAAAGG + Intergenic
972392501 4:38626846-38626868 GGCCTTGGCAAGCCCAGAAAGGG - Intergenic
975055350 4:69923833-69923855 GGCCTTGGCCAGCACAGAAAGGG - Intergenic
976146919 4:82051203-82051225 GGCCTGGTTCACCACAGTGATGG + Intergenic
977507693 4:97923195-97923217 GGCCTGGGCCATCCCAGAAAGGG - Intronic
977621447 4:99142251-99142273 GTCCTGGGTATCCAGAGGAAGGG - Intronic
980093911 4:128470235-128470257 GGCCCAGGTAAGCACAGAATGGG - Intergenic
980593936 4:134928360-134928382 TGCCTGGGTATCCCCAGAAGAGG + Intergenic
987347483 5:16991357-16991379 GGCCTTGGTCAGCCCAGAAAGGG + Intergenic
989253571 5:39343036-39343058 GGCCTCTTAAACCACAGAAAAGG + Intronic
989965775 5:50464956-50464978 GGCCTTGGTCAGCCCAGAAAGGG - Intergenic
994776832 5:104045510-104045532 TGCCTTGGAGACCACAGAAAAGG - Intergenic
996185089 5:120464740-120464762 CTCCTGGGAAACTACAGAAAAGG + Intronic
998069458 5:139185649-139185671 GCCCTGGGTAACTAGAGAATTGG - Intronic
998924879 5:147111959-147111981 GGCCTGGGTTAGCAAAGAAAAGG + Intergenic
999211618 5:149894508-149894530 TGCCAGGCTAACTACAGAAATGG + Intronic
1001274300 5:170339175-170339197 GCCCTTGGGACCCACAGAAATGG - Intergenic
1001415725 5:171543778-171543800 GGCCTGTGGAAACACAGCAAAGG + Intergenic
1001425278 5:171618524-171618546 GGCCTGGGCAGCCCCAGGAAAGG - Intergenic
1002586101 5:180249370-180249392 GGCCTGCGAGACCACAGAAAGGG - Intronic
1002604213 5:180372230-180372252 TGCCTGGGAGGCCACAGAAATGG - Intergenic
1002702549 5:181135565-181135587 GGTCTGGAGAACAACAGAAAGGG + Intergenic
1002721727 5:181265459-181265481 GGCCTGGGAAAACACGGAAGAGG + Intergenic
1003148705 6:3530657-3530679 GGCCTGGGAAGCCACTGAACGGG + Intergenic
1004438486 6:15621903-15621925 GGTCTGGGGAAGCACAGAAGAGG - Intronic
1005276396 6:24223786-24223808 GGCCAGTGTAACCACCAAAATGG + Intronic
1007582326 6:42966856-42966878 GCCCTAGGGAACCACAGGAAAGG + Exonic
1011041934 6:83039280-83039302 TTCCTGGGAAACCACAGAATAGG + Intronic
1011364878 6:86570428-86570450 TGCCTGGGTATCCACAGTGATGG - Intergenic
1012024404 6:93970433-93970455 GGATTGGGTAACCGCAGAGAGGG - Intergenic
1012765223 6:103358280-103358302 GGCCTCAGTAATCACAGCAATGG - Intergenic
1013453092 6:110303998-110304020 TGCCTGGGTATCACCAGAAAAGG - Intronic
1013960041 6:115889047-115889069 GGCCTTGGCCACCCCAGAAAGGG - Intergenic
1015632878 6:135248649-135248671 GGCCTGAGTAACCTCACATAAGG - Intergenic
1019214440 6:170434280-170434302 GGTCTGGGGAAACACAGACAAGG + Intergenic
1019476100 7:1245098-1245120 GGCCTGGGAAAAAACAGAATGGG + Intergenic
1019577450 7:1744367-1744389 GGCCTCGGTCACCACAGGACTGG + Exonic
1021748414 7:23768181-23768203 TGCCTATGTAAACACAGAAAAGG - Intronic
1023636580 7:42217280-42217302 AGCCTGGCTGACCACAGGAAAGG + Intronic
1030190390 7:106804840-106804862 GGCCTGAGCAACCACAAAAATGG + Intergenic
1031100325 7:117471821-117471843 GGCCTGGGTAAGTACAAAAAAGG + Intronic
1031847108 7:126819074-126819096 TGGCTGGGTAGACACAGAAACGG - Intronic
1032517742 7:132519445-132519467 GACCTTGGGAACCACAGAAAAGG + Intronic
1033663835 7:143422868-143422890 GGCCTGGCTAACCTCAGCACTGG + Intergenic
1037417631 8:18668102-18668124 GGCCTCGGTCAGCCCAGAAACGG + Intronic
1038433840 8:27520954-27520976 GGCCTGGGTAATTAAAGAAAAGG + Intronic
1039419184 8:37421311-37421333 GGCTTGGGTACCCACAAAACAGG - Intergenic
1040829324 8:51660340-51660362 GGCCTGGGTATCCTCAGGAAGGG - Intronic
1043494277 8:80782998-80783020 GTACTTGGAAACCACAGAAATGG + Intronic
1045633568 8:104156202-104156224 GCCCTGGATGACTACAGAAAAGG - Intronic
1047402547 8:124558712-124558734 TGCCTGGGTGTCCACAGAGAAGG - Intronic
1048917002 8:139194745-139194767 GGCCTGGGAAAGCAGAGTAAGGG - Intergenic
1050931297 9:11330603-11330625 GGCCTGGCCAGCCACAGAAGTGG - Intergenic
1051223541 9:14875954-14875976 TGCCTGGGTATCCACAGCAGTGG + Intronic
1051488891 9:17638691-17638713 GGGCAGGGTAACCACAGTAGAGG - Intronic
1054257186 9:62827640-62827662 TGCCTGGGTATCAACAGAGAAGG + Intergenic
1054334129 9:63788085-63788107 TGCCTGGGTATCAACAGAGAAGG - Intergenic
1054841647 9:69748134-69748156 GGCCTGGTCAGCCAAAGAAATGG + Intronic
1055971257 9:81915219-81915241 GGCGTGGGTCCCCACAGGAATGG + Intergenic
1056972529 9:91219049-91219071 CGGCTGGGTAACCACACAATGGG + Intronic
1059363672 9:113768395-113768417 TGCCAGGGTAACCACAGTCAAGG + Intergenic
1061378696 9:130241372-130241394 TCACTGGGTAACCACAGGAAGGG + Intergenic
1187098473 X:16169658-16169680 GGCCTGGGAAACCTCAGGAGAGG + Intronic
1188187577 X:27133523-27133545 GTCCTGGGTAACCAGACACATGG - Intergenic
1192442023 X:71181722-71181744 GGCCAGGGTAACCGCAGAACCGG - Intergenic
1192503644 X:71668322-71668344 GGCCTGGGAGAACCCAGAAAGGG + Intergenic
1195539564 X:106047218-106047240 GGTGGGGCTAACCACAGAAAGGG - Intergenic
1198320756 X:135516678-135516700 GGGCTGGGTAACCCTAGGAAAGG + Intergenic
1199978454 X:152907821-152907843 GGCCTGGGCCACCAAAGGAATGG - Intergenic