ID: 1103454858

View in Genome Browser
Species Human (GRCh38)
Location 12:121057277-121057299
Sequence TGTTTCTGTATTGGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103454858_1103454863 20 Left 1103454858 12:121057277-121057299 CCCTTCTTCCCAATACAGAAACA No data
Right 1103454863 12:121057320-121057342 TTACCGATGTTTATTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103454858 Original CRISPR TGTTTCTGTATTGGGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr