ID: 1103454861

View in Genome Browser
Species Human (GRCh38)
Location 12:121057286-121057308
Sequence GAAGGACTTTGTTTCTGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103454861_1103454863 11 Left 1103454861 12:121057286-121057308 CCAATACAGAAACAAAGTCCTTC No data
Right 1103454863 12:121057320-121057342 TTACCGATGTTTATTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103454861 Original CRISPR GAAGGACTTTGTTTCTGTAT TGG (reversed) Intergenic
No off target data available for this crispr