ID: 1103454862

View in Genome Browser
Species Human (GRCh38)
Location 12:121057304-121057326
Sequence TCGGTAAACAAGCAACAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103454862_1103454865 25 Left 1103454862 12:121057304-121057326 CCTTCTTGTTGCTTGTTTACCGA No data
Right 1103454865 12:121057352-121057374 TCTATAGATAACTTTGTTGTAGG No data
1103454862_1103454863 -7 Left 1103454862 12:121057304-121057326 CCTTCTTGTTGCTTGTTTACCGA No data
Right 1103454863 12:121057320-121057342 TTACCGATGTTTATTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103454862 Original CRISPR TCGGTAAACAAGCAACAAGA AGG (reversed) Intergenic
No off target data available for this crispr