ID: 1103454863

View in Genome Browser
Species Human (GRCh38)
Location 12:121057320-121057342
Sequence TTACCGATGTTTATTCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103454860_1103454863 12 Left 1103454860 12:121057285-121057307 CCCAATACAGAAACAAAGTCCTT No data
Right 1103454863 12:121057320-121057342 TTACCGATGTTTATTCAGACAGG No data
1103454862_1103454863 -7 Left 1103454862 12:121057304-121057326 CCTTCTTGTTGCTTGTTTACCGA No data
Right 1103454863 12:121057320-121057342 TTACCGATGTTTATTCAGACAGG No data
1103454861_1103454863 11 Left 1103454861 12:121057286-121057308 CCAATACAGAAACAAAGTCCTTC No data
Right 1103454863 12:121057320-121057342 TTACCGATGTTTATTCAGACAGG No data
1103454859_1103454863 19 Left 1103454859 12:121057278-121057300 CCTTCTTCCCAATACAGAAACAA No data
Right 1103454863 12:121057320-121057342 TTACCGATGTTTATTCAGACAGG No data
1103454858_1103454863 20 Left 1103454858 12:121057277-121057299 CCCTTCTTCCCAATACAGAAACA No data
Right 1103454863 12:121057320-121057342 TTACCGATGTTTATTCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103454863 Original CRISPR TTACCGATGTTTATTCAGAC AGG Intergenic
No off target data available for this crispr