ID: 1103454865

View in Genome Browser
Species Human (GRCh38)
Location 12:121057352-121057374
Sequence TCTATAGATAACTTTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103454862_1103454865 25 Left 1103454862 12:121057304-121057326 CCTTCTTGTTGCTTGTTTACCGA No data
Right 1103454865 12:121057352-121057374 TCTATAGATAACTTTGTTGTAGG No data
1103454864_1103454865 6 Left 1103454864 12:121057323-121057345 CCGATGTTTATTCAGACAGGATC No data
Right 1103454865 12:121057352-121057374 TCTATAGATAACTTTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103454865 Original CRISPR TCTATAGATAACTTTGTTGT AGG Intergenic
No off target data available for this crispr