ID: 1103458993

View in Genome Browser
Species Human (GRCh38)
Location 12:121089066-121089088
Sequence ACTGAACGAGGCGTCTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103458993_1103458996 -7 Left 1103458993 12:121089066-121089088 CCTGGGAAGACGCCTCGTTCAGT No data
Right 1103458996 12:121089082-121089104 GTTCAGTGAGAAGGTCCAACAGG No data
1103458993_1103458998 8 Left 1103458993 12:121089066-121089088 CCTGGGAAGACGCCTCGTTCAGT No data
Right 1103458998 12:121089097-121089119 CCAACAGGCTGAACAGTGTGAGG No data
1103458993_1103458999 11 Left 1103458993 12:121089066-121089088 CCTGGGAAGACGCCTCGTTCAGT No data
Right 1103458999 12:121089100-121089122 ACAGGCTGAACAGTGTGAGGAGG No data
1103458993_1103459000 12 Left 1103458993 12:121089066-121089088 CCTGGGAAGACGCCTCGTTCAGT No data
Right 1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103458993 Original CRISPR ACTGAACGAGGCGTCTTCCC AGG (reversed) Intergenic
No off target data available for this crispr