ID: 1103458995

View in Genome Browser
Species Human (GRCh38)
Location 12:121089078-121089100
Sequence TTGGACCTTCTCACTGAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103458995_1103459000 0 Left 1103458995 12:121089078-121089100 CCTCGTTCAGTGAGAAGGTCCAA No data
Right 1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG No data
1103458995_1103458998 -4 Left 1103458995 12:121089078-121089100 CCTCGTTCAGTGAGAAGGTCCAA No data
Right 1103458998 12:121089097-121089119 CCAACAGGCTGAACAGTGTGAGG No data
1103458995_1103458999 -1 Left 1103458995 12:121089078-121089100 CCTCGTTCAGTGAGAAGGTCCAA No data
Right 1103458999 12:121089100-121089122 ACAGGCTGAACAGTGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103458995 Original CRISPR TTGGACCTTCTCACTGAACG AGG (reversed) Intergenic
No off target data available for this crispr