ID: 1103458996

View in Genome Browser
Species Human (GRCh38)
Location 12:121089082-121089104
Sequence GTTCAGTGAGAAGGTCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103458983_1103458996 25 Left 1103458983 12:121089034-121089056 CCACCCTCACCACCCTCTGACTT No data
Right 1103458996 12:121089082-121089104 GTTCAGTGAGAAGGTCCAACAGG No data
1103458982_1103458996 26 Left 1103458982 12:121089033-121089055 CCCACCCTCACCACCCTCTGACT No data
Right 1103458996 12:121089082-121089104 GTTCAGTGAGAAGGTCCAACAGG No data
1103458990_1103458996 12 Left 1103458990 12:121089047-121089069 CCTCTGACTTGGGTCAGATCCTG No data
Right 1103458996 12:121089082-121089104 GTTCAGTGAGAAGGTCCAACAGG No data
1103458988_1103458996 16 Left 1103458988 12:121089043-121089065 CCACCCTCTGACTTGGGTCAGAT No data
Right 1103458996 12:121089082-121089104 GTTCAGTGAGAAGGTCCAACAGG No data
1103458993_1103458996 -7 Left 1103458993 12:121089066-121089088 CCTGGGAAGACGCCTCGTTCAGT No data
Right 1103458996 12:121089082-121089104 GTTCAGTGAGAAGGTCCAACAGG No data
1103458989_1103458996 13 Left 1103458989 12:121089046-121089068 CCCTCTGACTTGGGTCAGATCCT No data
Right 1103458996 12:121089082-121089104 GTTCAGTGAGAAGGTCCAACAGG No data
1103458987_1103458996 21 Left 1103458987 12:121089038-121089060 CCTCACCACCCTCTGACTTGGGT No data
Right 1103458996 12:121089082-121089104 GTTCAGTGAGAAGGTCCAACAGG No data
1103458985_1103458996 22 Left 1103458985 12:121089037-121089059 CCCTCACCACCCTCTGACTTGGG No data
Right 1103458996 12:121089082-121089104 GTTCAGTGAGAAGGTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103458996 Original CRISPR GTTCAGTGAGAAGGTCCAAC AGG Intergenic
No off target data available for this crispr