ID: 1103458998

View in Genome Browser
Species Human (GRCh38)
Location 12:121089097-121089119
Sequence CCAACAGGCTGAACAGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103458995_1103458998 -4 Left 1103458995 12:121089078-121089100 CCTCGTTCAGTGAGAAGGTCCAA No data
Right 1103458998 12:121089097-121089119 CCAACAGGCTGAACAGTGTGAGG No data
1103458990_1103458998 27 Left 1103458990 12:121089047-121089069 CCTCTGACTTGGGTCAGATCCTG No data
Right 1103458998 12:121089097-121089119 CCAACAGGCTGAACAGTGTGAGG No data
1103458989_1103458998 28 Left 1103458989 12:121089046-121089068 CCCTCTGACTTGGGTCAGATCCT No data
Right 1103458998 12:121089097-121089119 CCAACAGGCTGAACAGTGTGAGG No data
1103458993_1103458998 8 Left 1103458993 12:121089066-121089088 CCTGGGAAGACGCCTCGTTCAGT No data
Right 1103458998 12:121089097-121089119 CCAACAGGCTGAACAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103458998 Original CRISPR CCAACAGGCTGAACAGTGTG AGG Intergenic
No off target data available for this crispr